...workshops at the Future of Research Symposium 2014, young scientists are acutely aware of these problems that...new approaches that address the need to train our young scientists for futures both inside and outside of...Paula Stephan, professor of economics at the Andrew Young School of Policy Studies at Georgia State University...diversity of trainee backgrounds, publishing from a young scientist’s perspective, and the many different ...

...Many thanks to our guest blogger Samantha Young. Samantha Young is a Medical Writer with a PhD in reproductive... post was contributed by guest blogger Samantha Young. The use of CRISPR/Cas9 for gene editing has expanded... in scientific content.      References 1. Cho, Seung Woo, et al. "Analysis of off-target effects of CRISPR...

...linings of certain areas of the body, including the lung, the heart, and the abdomen. Long story short, when...frequently, ingested), it can get into the lining of the lungs or travel to one of the other areas of the body,...of other diseases, such as asthma, pneumonia, or lung cancer. As a result, mesothelioma is often misdiagnosed... from the government as more common cancers like lung (about 224,000 diagnosed this year) or breast cancer...

...proteins protect fragile samples during cryo-EM grid plunge freezing By Rachel Leeson Cryo-EM samples can be...glutaraldehyde. Adding RvLEAMshort to the sample before plunge freezing represents a convenient, effective approach...protectant for fragile samples during cryo-EM grid plunge freezing. bioRxiv 2024.02.06.579238. doi: https..., J. M., Adriaens, C., Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., … & Weissman, J. S. (2021...

...Montreal, QC, Canada 45.5017°N 73.5673°W – Vanessa Sung Hundreds of scientists and supporters in Montreal...allies outside the scientific community. Vanessa Sung is currently a PhD student studying breast cancer...restorative justice.  Follow her on twitter @sung_vanessa. Albany, NY, USA 42.6526°N 73.7562°W – Nicholas... Astronomy. She studies how planets form around young stars and the instruments we use to study them. ...

...across the USA during this time have revealed that young scientists are aware of, and are engaged in, these...change the landscape facing all scientists, both young and established, as they embark on or continue their...along with progress over the past two years give young academic scientists a foot in the door, but we will...

..., which is critically important, especially for young researchers. It was a really nice incubator for ...academic positions and poor grant situation. So, young researchers need to publish good publications in...transforming conventional research. So, I hope my younger colleagues may be able to develop new technologies...

..., Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R (2016) Editing DNA Methylation in...Reyon D, Bernstein BE, Costello JF, Wilkinson MF, Joung JK (2013) Targeted DNA demethylation and activation...Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE (2013) Locus-specific editing of...

...experiments move closer to the clinic (Tsai and Joung 2016). Table 2: Unbiased Genotyping Options Technique...specificities of CRISPR–Cas9 nucleases”
by Tsai and Joung 2016. Many thanks to our guest blogger Søren Hough...PMC3651036. 15. Tsai, Shengdar Q., and J. Keith Joung. "Defining and improving the genome-wide specificities...

...Heart AAV1, AAV8, AAV9 Liver AAV7, AAV8, AAV9 Lung AAV4, AAV5, AAV6, AAV9 RPE (Retinal Pigment Epithelium...PMC4678200.  Kohara, K., Pignatelli, M., Rivest, A.J., Jung, H.-Y., Kitamura, T., Suh, J., Frank, D., Kajikawa...R.J.O., Mori, T., Finke, S., Conzelmann, K.-K., Young, J.A., and Callaway, E.M. (2007). Monosynaptic Restriction...

...pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243 cut S. pyogenes 23360964 Joung GABPA H. sapiens...pyogenes 23360964 Joung RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes 23792628 Joung rol-6(su1006...pyogenes 23360964 Joung tph1a D. rerio GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung TRE3G H. sapiens...pyogenes 23792628 Joung VEGF H. sapiens GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung VEGF H. sapiens...GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes 23360964 Joung ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...GGAAACTACAGCCCAGCGTC 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut...

...advent tree displaying over 25 archaea, bacteria, fungi, and viruses. Final tree with the complete #MicrobeAdventCalendar...set (plus more!) It features archaea, bacteria, fungi, viruses, and one microbe ornament even dyed with...

... field – Jennifer Doudna, Feng Zhang, and Keith Joung. All Addgene depositors! Addgene was mentioned specifically...dramatically and reducing off-target effects. Other young scientists discussed new CRISPR delivery systems...

...wanted to run and play with my kids like any other youngster. His parents, Kristi and Rico, had to keep him...Kurt has been running on behalf of AJ Gonzales, a young boy suffering from FOP, raising money for NORD for...

..., cut S. pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter...Mammalian U6 none As Cpf1 Joung BPK3082 78742 Mammalian U6 none Lb Cpf1 Joung pLentiCRISPR-E 78852 Mammalian... meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus Joung BPK2101 65770 ...Goldstein DR274 42250 C. elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes... MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach...pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen) 48140 Mammalian BbsI yes, nick S...Wente DR274 42250 Zebrafish BsaI none S. pyogenes Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere...

...calcineurin is required for virulence in pathogenic fungi, it is an attractive drug target. Calcineurin reporters...as a drug-screening platform to identify new antifungals that target calcineurin. Current calcineurin ...

... KK-H, Zhang X, Fung AY-F, Tsoi H-W, Cai J-P, Chan W-M, Ip JD, Chu AW-H, Zhou J, Lung DC, Kok K-H, To ...

...Ahringer Alexander Stark Bas van Steensel Richard Young Yi Zhang Leonard Zon  You!     Chromatin-related.... Gong F, Chiu LY, Cox B, Aymard F, Clouaire T, Leung JW, Cammarata M, Perez M, Agarwal P, Brodbelt JS...

...role in Cas9 activity and efficiency (Sander and Joung, 2014). Thus it is essential to identify the best...//doi.org/10.3389/fcell.2018.00054 Sander JD, Joung JK (2014) CRISPR-Cas systems for editing, regulating...

...Axel Brunger 12339 pBD-0071 VCP His T7 ALS Axel Brunger 12344 pBD-0010 VCP His T7 ALS Axel Brunger 12345...Axel Brunger 12346 pBD-0013 VCP His T7 ALS Axel Brunger 12347 pBD-0006 VCP His T7 ALS Axel Brunger 12348...Axel Brunger 12349 pBD-0070 VCP His T7 ALS Axel Brunger 12350 pBD-0069 VCP His T7 ALS Axel Brunger 12351...Axel Brunger 12352 pBD-0007 VCP His T7 ALS Axel Brunger 12353 pBD-0018 VCP His T7 ALS Axel Brunger 12354...Axel Brunger 12355 pBD-0022 VCP His T7 ALS Axel Brunger 12356 pBD-0024 VCP His T7 ALS Axel Brunger 12357...Axel Brunger 12358 pBD-0035 VCP His T7 ALS Axel Brunger 12359 pBD-0039 VCP His T7 ALS Axel Brunger 12360...Axel Brunger 12361 pBD-0072 VCP His T7 ALS Axel Brunger 12362 pBD-0050 VCP His T7 ALS Axel Brunger 12363...