... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT ...

...Generally, you will need two plasmids, as depicted in the figure below: A plasmid expressing the tRNA and ... included. Browse Synthetase Plasmids The table below highlights plasmids that contain aminoacyl tRNA ...Many of the plasmids also contain one or more copies of the cognate tRNA gene. ID Plasmid Synthetase Origin...Abhishek Chatterjee Browse Target Plasmids The table below highlights plasmids that contain genes with modified...Addgene's guide to plasmids and strains useful for expanding the genetic code in bacteria and mammalian... Plasmid Collections Genetic Code Expansion Genetic Code Expansion You may also like... GCE4All...tRNA synthetases are introduced into the cell on plasmids and the new amino acid is introduced in the media...

...Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 ...76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid) Knockout Human Doench and Root 3rd... 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 ...20,051 Human GeCKO v2 1000000048 (1 plasmid) 1000000049 (2 plasmid) Knockout Human Zhang 3rd 6 123,411...185,836 Mouse GeCKO v2 1000000052 (1 plasmid) 1000000053 (2 plasmid) Knockout Mouse Zhang 3rd 6 130,209... - 3 plasmid system 1000000075 (Puromycin) Activation Mouse Zhang 3rd 3 69,716 SAM v2 - 2 plasmid system...

...Neurosci 2016. PubMed PMID: 26950006 Plasmid ID Plasmid Name Plasmid Type 74309 pcDNA3.0-TRPV4-p2A-ferritin-p2A-mCherry...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These brief articles...features and applications of a partiular plasmid or set of plasmids. We hope that these articles make it ... you to find and use the plasmids you need. You can find all the hot plasmids from 2016 below. With over...over 45,000 plasmids, we can't write posts for every great plasmid that comes into the repository, but...write about your plasmids in a future blog post. No time to read? Listen to our hot plasmids segment on the...stocks in a single plate with every plasmid or as individual plasmids shipped as agar stabs. Iverson, et...

... Plasmid Collections Cre-lox Plasmids Cre-lox Plasmids Additional...Cre-lox Plasmids Addgene's Blog: Cre-lox Addgene's Blog: FLEx Vectors Cre-containing Plasmids loxP Constructs...viral preparations of plasmids that are currently in our repository. ID Plasmid Description Promoter Expression...loxP plasmids, reporter genes indicate which cells have undergone Cre recombination. These plasmids can...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail... Cre-lox plasmids for your experiments. Plasmid...alternatives from Gerald Rubin's lab. Cre-containing Plasmids Scientists have developed ways to tightly control...

...because it relies on a single BiFC pair. Find BiFC plasmids for your experiment at Addgene! How to Design ...straightforward in easy-to-transfect cell lines where plasmid dosage can be tightly controlled. This is also ...Resources on Addgene.org Find fluorescent protein plasmids and resources Visit our Molecular Biology Reference...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and...

... Biosensors Luciferase Plasmids Subcellular Localization Optogenetics Plasmids Viral Service: AAV Biosensors...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Collection of plasmids encoding fluorescent biosensors to measure biomolecules or genes via FRET or other... Plasmid Collections Fluorescent Proteins Fluorescent Biosensors Fluorescent Proteins: Biosensors...our catalog . Use the article links to find the plasmids associated with the article. We also offer ready-to-use...ready-to-use AAV preparations of select plasmids; these are noted with the viral service icon . Metal Ions... localized dTomato fluorophore Ting Lab GCaMP6 Plasmids 2014 Jonathan Ting Calcium Intersectional viral...

...delivery of a plasmid. Below, browse our selection of empty vectors for cloning in shRNAs. Plasmids for constitutive...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral... Plasmid Collections Mammalian RNAi Mammalian shRNA Tools... libraries Lentiviral packaging and expression plasmids Background RNA interference (RNAi) is an RNA-mediated...inducible (Tet) expression are available. To find plasmids containing RNAi components, like Argonaute, please...Lentiviral vectors for constitutive shRNA expression ID Plasmid Description PI 10878 pLKO.1 ‐ TRC cloning vector... for conditional (Cre-lox) shRNA expression ID Plasmid Description PI 11578 pSico Cre addition causes ...

... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Fluorescent Proteins Cancer Research Plasmids Gene Categories Plasmid Tables Additional Resources Mammalian...to the available plasmids for each gene. Please note that not all genes have plasmids available for request...and apoptosis. Plasmid Tables The gene names in these tables link to the available plasmids for each gene...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...rapidly initiate a secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped...