...morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) under the control of Cre recombinase. After in-utero...and synaptic proteins (e.g. postsynaptic PSD95-mcherry) are used in high concentrations in combination...morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the control of Flp recombinase together...

...colocalization of GFP tagged HA frankenbody with an mCherry, 4xHA tagged histone protein (H2B) in U2OS cells... other fluorescent proteins and tags including mCherry, HaloTag and SNAP-tag for multi-color imaging. ...

... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...

...designed by putting together the coding sequence of a mCherry fluorescent protein followed by a stop codon and... flow cytometry is used to sort populations by mCherry and GFP expression to check for ABE’s. b) Quantification...

...promoter drives expression of an mCherry reporter.  After using mCherry for FACS sorting of the weaponized...

...of pHAGE-TO-dCas9-3XmCherry . 72 h post transduction, cells were assayed for mCherry expression using ...

...). In a HEK293 mCherry reporter assay, CasRx and AdmCas13d produced 92% and 87% mCherry protein knockdown...

... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...

...and modulate transcription of the mCitrine gene. mCherry is constitutively expressed. Cells are then cultured...mDlx-GCaMP6f, hDlx-GiDREADD-dTomato and mDlx-ChR2-mCherry. Find these AAVs at Addgene ...

...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...

... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...

... activity. EB3N-VVDfast-iLID (anchor) and SspB-mCherry-p60 (katanin) are recruited to microtubules under...the EB3N-VVDfast-iLID anchor module and the SspB-mCherry-p60 katanin module, which are also available as...

...), tagRFP (pKa = 3.1) and mCherry (pKa = 3.8). We have observed that mCherry (and mTurquoise2, not shown...

...(Gq)-mCherry hM3D (Gq) Syn mCherry No Roth 50475 pAAV-hSyn-hM4D(Gi)-mCherry hM4D (Gi) Syn mCherry No Roth...Gq)-mCherry hM3D (Gq) GFAP mCherry No Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry hM4D (Gi) GFAP mCherry No ...pAAV-CaMKIIa-hM3D(Gq)-mCherry hM3D (Gq) CaMKIIa mCherry No Roth 50477 pAAV-CaMKIIa-hM4D(Gi)-mCherry hM4D (Gi) CaMKIIa...pAAV-hSyn-DIO-hM3D(Gq)-mCherry hM3D (Gq) Syn mCherry Yes Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry hM4D (Gi) Syn...Syn mCherry Yes Roth 50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry rM3D (Gs) Syn mCherry Yes Roth 50474 pAAV-hSyn-hM3D...-hM3D(Gq)-mCherry hM3D (Gq) EF1a mCherry Yes Roth 183532 pAAV-nEF Con/Fon DREADD Gq-mCherry hM3D (Gq) ... EF1a mCherry Cre AND Flp Deisseroth 50461 pAAV-EF1a-DIO-hM4D(Gi)-mCherry hM4D (Gi) EF1a mCherry Yes Roth...

...pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry hM4D(Gi...PI 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry rM3D(Gs) - Activation mCherry fusion Cre-dependent 8 Roth 50474...50474 pAAV-hSyn-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 2, 5, 8, 9, rg* Roth 50475 pAAV-hSyn-hM4D...pAAV-hSyn-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion none 2, 5, 8, 9, rg* Roth 154867 pAAV-...pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA hM4D(Gi) - Inhibition mCherry fusion Flp-dependent 8, rg* Gether 154868...

...reporter activation and silencing of factor-linked mCherry). They additionally discovered that monocistronic...last month, Robert Campbell’s lab added two new mCherry variants to the repository. These variants can ...ONE paper for more on the directed evolution of mCherry and the spectral properties of various RFPs. For...Listen to Our Podcast Segment on PhoCl LSSmCherry1 & RDSmCherry1: Engineering and directed evolution of...influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which could be...two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with further ...

...21217 PGK-H2BmCherry Chromatin H2B mCherry Mark Mercola 20972 H2B-mCherry Chromatin H2B mCherry Robert Benezra...55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001 mCherry-Beta-... PI 110060 FUW mCherry-GFP-LC3 Autophagosome LC3 mCherry, GFP Anne Brunet 40827 mCherry-hLC3B-pcDNA3.1...mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae Cav1 mCherry Ari Helenius 37533 cfSGFP2-N Extracellular...gamma GFP Tom Misteli 55068 mCherry-LaminA-C-18 Nuclear Envelope LaminA1 mCherry* Michael Davidson 98831 ...mTurquoise2 Dorus Gadella 55069 mCherry-LaminB1-10 Nuclear Envelope LaminB1 mCherry* Michael Davidson 98822 Lck-mTurquoise2...Voeltz 55102 mCherry-Mito-7 Mitochondria Mitochondrial targeting sequence(COX8A) mCherry* Michael Davidson...

...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...

...Fon-mCherry EF1a mCherry Cre and Flp dependent 8 Deisseroth 137133 pAAV-Ef1a-Con/Foff 2.0-mCherry EF1a...EF1a mCherry Cre dependent 8 Deisseroth 137134 pAAV-Ef1a-Coff/Fon-mCherry EF1a mCherry Flp dependent 8 Deisseroth...Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato...Constitutive 2 Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB...PHP.eB Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Deisseroth...Deisseroth 114472 pAAV-hSyn-mCherry hSyn mCherry Constitutive 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP ...112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, ...

...pAAV-hSyn-mCherry Syn mCherry Control Deisseroth 114469 pAAV-CaMKIIa-mCherry CamKII mCherry Control Deisseroth...pAAV-Ef1a-mCherry EF1a mCherry Control Deisseroth 114471 pAAV-Ef1a-fDIO mCherry EF1a mCherry, Flp-dependent...Deisseroth 50459 pAAV-hSyn-DIO-mCherry Syn mCherry, Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato...pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a Color-flipping switch. Expresses NLS-mCherry in the absence of Cre...Aebischer 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a Cre and physically-separate mCherry expression Recombinases...Wilson 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a Flpo and physically-separate mCherry expression Recombinases...pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator, Cre-dependent DREADD Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Syn Inhibitor...