Skip to main content
Addgene
Showing: 21 - 40 of 91 results
  1. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...traditional homologous recombination methods). By using mCherry for selection of sgRNA plasmid transformants, they...with the sgRNA cassette on a plasmid expressing mCherry and resistance selection marker HygR. The CRISPR...disruption of the target gene. Lastly, curing the mCherry-sgRNA plasmid leaves an edited strain carrying ...
  2. Advanced Uses of Cre-lox and Flp-FRT - A Neuroscientist’s View

    Type
    Blog Post
    ...morphology (eYFP) and the synaptic protein PSD95 (PSD95-mcherry) under the control of Cre recombinase. After in-utero...and synaptic proteins (e.g. postsynaptic PSD95-mcherry) are used in high concentrations in combination...morphological marker (eYFP) and synaptic marker (PSD95-mcherry), under the control of Flp recombinase together...
  3. Visualizing Translation at the Single Molecule Level

    Type
    Blog Post
    ... 3’ UTR of the reporter mRNA is labeled by PCP-mCherry (Figure 2). The 3’ UTR also contains a CAAX sequence...membrane; this sequence prevents diffusion of the mCherry labeled mRNA and keeps it in a single field of ...
  4. Hot Plasmids and Viral Preps - September 2021

    Type
    Blog Post
    ...designed by putting together the coding sequence of a mCherry fluorescent protein followed by a stop codon and... flow cytometry is used to sort populations by mCherry and GFP expression to check for ABE’s. b) Quantification...
  5. Hot Plasmids - January 2023

    Type
    Blog Post
    ...promoter drives expression of an mCherry reporter.  After using mCherry for FACS sorting of the weaponized...
  6. Fluorescence Titering Assay

    Type
    Protocol
    ...of pHAGE-TO-dCas9-3XmCherry . 72 h post transduction, cells were assayed for mCherry expression using ...
  7. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... as the first letter in the protein name, e.g. mCherry). Oxygen: The maturation of the chromophore on ...sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours...
  8. Hot Plasmids - August 2020

    Type
    Blog Post
    ...and modulate transcription of the mCitrine gene. mCherry is constitutively expressed. Cells are then cultured...mDlx-GCaMP6f, hDlx-GiDREADD-dTomato and mDlx-ChR2-mCherry. Find these AAVs at Addgene ...
  9. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...mutagenesis screening for enhanced RFP variants. PA-mCherry (E26V / A58T / K69N / L84F / N99K / S148L / I165V...UV-Violet or blue Green/ Red 4,500 High 553/ 573 PA-mCherries Monomer UV-Violet Dark/ Red >3,000 Medium 570/.... 2.Subach, Fedor V., et al. "Photoactivatable mCherry for high-resolution two-color fluorescence microscopy...
  10. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ... ER mCherry-Sec61 beta BFP-Sec61 beta BFP-KDEL Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin...mito-BFP mCherry-Drp1 (GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or...one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize simultaneously...mCherry-alpha-tubulin Early Endosome Vacuolar Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment...
  11. Chemogenetics Plasmids

    Type
    Collection
    ...(Gq)-mCherry hM3D (Gq) Syn mCherry No Roth 50475 pAAV-hSyn-hM4D(Gi)-mCherry hM4D (Gi) Syn mCherry No Roth...Gq)-mCherry hM3D (Gq) GFAP mCherry No Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry hM4D (Gi) GFAP mCherry No ...pAAV-CaMKIIa-hM3D(Gq)-mCherry hM3D (Gq) CaMKIIa mCherry No Roth 50477 pAAV-CaMKIIa-hM4D(Gi)-mCherry hM4D (Gi) CaMKIIa...pAAV-hSyn-DIO-hM3D(Gq)-mCherry hM3D (Gq) Syn mCherry Yes Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry hM4D (Gi) Syn...Syn mCherry Yes Roth 50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry rM3D (Gs) Syn mCherry Yes Roth 50474 pAAV-hSyn-hM3D...-hM3D(Gq)-mCherry hM3D (Gq) EF1a mCherry Yes Roth 183532 pAAV-nEF Con/Fon DREADD Gq-mCherry hM3D (Gq) ... EF1a mCherry Cre AND Flp Deisseroth 50461 pAAV-EF1a-DIO-hM4D(Gi)-mCherry hM4D (Gi) EF1a mCherry Yes Roth...
  12. Chemogenetics AAV Preps

    Type
    Collection
    ...pAAV-GFAP-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 5 Roth 50479 pAAV-GFAP-hM4D(Gi)-mCherry hM4D(Gi...PI 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 44362 pAAV-hSyn-DIO-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion Cre-dependent 1, 2, 5, 8,...Roth 50458 pAAV-hSyn-DIO-rM3D(Gs)-mCherry rM3D(Gs) - Activation mCherry fusion Cre-dependent 8 Roth 50474...50474 pAAV-hSyn-hM3D(Gq)-mCherry hM3D(Gq) - Activation mCherry fusion none 2, 5, 8, 9, rg* Roth 50475 pAAV-hSyn-hM4D...pAAV-hSyn-hM4D(Gi)-mCherry hM4D(Gi) - Inhibition mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 52536 rAAV-CAG...154867 pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA hM4D(Gi) - Inhibition mCherry fusion Flp-dependent 8, rg* ...
  13. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...21217 PGK-H2BmCherry Chromatin H2B mCherry Mark Mercola 20972 H2B-mCherry Chromatin H2B mCherry Robert Benezra...55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001 mCherry-Beta-... PI 110060 FUW mCherry-GFP-LC3 Autophagosome LC3 mCherry, GFP Anne Brunet 40827 mCherry-hLC3B-pcDNA3.1...mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae Cav1 mCherry Ari Helenius 37533 cfSGFP2-N Extracellular...gamma GFP Tom Misteli 55068 mCherry-LaminA-C-18 Nuclear Envelope LaminA1 mCherry* Michael Davidson 98831 ...mTurquoise2 Dorus Gadella 55069 mCherry-LaminB1-10 Nuclear Envelope LaminB1 mCherry* Michael Davidson 98822 Lck-mTurquoise2...Voeltz 55102 mCherry-Mito-7 Mitochondria Mitochondrial targeting sequence(COX8A) mCherry* Michael Davidson...
  14. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...reporter activation and silencing of factor-linked mCherry). They additionally discovered that monocistronic...last month, Robert Campbell’s lab added two new mCherry variants to the repository. These variants can ...ONE paper for more on the directed evolution of mCherry and the spectral properties of various RFPs. For...Listen to Our Podcast Segment on PhoCl LSSmCherry1 & RDSmCherry1: Engineering and directed evolution of...influence of structure on an FP’s properties. pBAD-LSSmCherry1 is a long Stokes shift variant, which could be...two-photon microscopy using Ti-Sapphire lasers. pBAD-RDSmCherry1 is a red-shifted variant which, with further ...
  15. Control AAV Preps

    Type
    Collection
    ...AAV-EF1a-BbChT EF1a mCherry and mTFP Cre dependent 9 Sanes 114471 pAAV-Ef1a-fDIO mCherry EF1a mCherry Flp dependent...Constitutive 5 Zeng 58909 pAAV-GFAP104-mCherry GFAP104 mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato...Constitutive 2 Patrick 114469 pAAV-CaMKIIa-mCherry CaMKIIa mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB...PHP.eB Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Deisseroth...Deisseroth 114472 pAAV-hSyn-mCherry hSyn mCherry Constitutive 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP ...112677 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP EF1a NLS-mCherry or nls-EGFP Cre dependent 1, 2, 5, ...1, 2, 5, 8, rg* Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, 9, rg* Roth 51502...
  16. Sequencing Primers

    Type
    Guide
    ...forward primer mCherry-F CCCCGTAATGCAGAAGAAGA 3' end of mCherry, forward primer mCherry-R TTGGTCACCTTCAGCTTGG...TTGGTCACCTTCAGCTTGG 5' end of mCherry, reverse primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein...
Showing: 21 - 40 of 91 results