...the reporter gene has over the years evolved from chloramphenicol acetyltransferase to luciferase, the...the development of a vast number expression and reporter plasmids and the free exchange of these vectors...

...Fluorescent Protein (GFP/EGFP) for a transcriptional reporter or as a general cytoplasmic label of cells, there's...Incorporation into a FRET biosensor A FRET biosensor is a reporter that undergoes a conformational change to bring...help you make better fluorescent fusion protein reporters for your studies and greatly lower your chances...Protein Resources Find Other Plasmids that Glow (Luciferase Plasmids) Find Optogenetics Resources ...FP dimerization. Equally problematic, several reportedly monomeric FPs are not actually monomeric, at ...

...their assay, the pseudoviruses express a luciferase reporter which is used as a readout for infection ...

... (abundant in eukaryotes) A Near-Infrared BiFC Reporter for In Vivo Imaging of Protein-Protein Interactions...green-yellow or orange-red fluorogen A split fluorescent reporter with rapid and reversible complementation. Tebo....org Fluorescent Biosensors Collection Split Luciferase systems, including NanoLuc®, DULIP, LuTHy Other...

...RNA editing tools.   Fig. 1 Schematic of luciferase RNA knockdown assays using Cas7-11   Use .... Specifically, efficacy rates of Cas7-11 were reported as up to 85%, broadly similar to shRNA and Cas13...However, in those same comparisons, the AbuGoot lab reported no detectable effect on cell viability – meaning...

...that constitutively expresses a reporter protein (e.g., GFP or luciferase) that is either co-transfected... well of your cells. Regardless, the amount of reporter protein activity correlates to both the amount...

...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...-ome using a quick, affordable, and ubiquitous reporter assay. In their recent publication, Kroeze et ...immunoprecipitated from the cells using the Protein A tag. The luciferase activities can then be measured and normalized... assess interactions. Higher relative firefly luciferase activity in the Co-IP compared of a control Co-IP...endogenous proteins. As described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using...TRIBE is the low input required - McMahon et al., report using as few as 150 fly neurons as their starting...delivery of robust CRISPR activators We previously reported on a novel Cas9-based activator developed by the...

...sites AAV Uchida Cre Reporters and Tools In this subtype of loxP plasmids, reporter genes indicate which...Mammalian Pelczar 62732 Cre Reporter DsRED and EGFP Cre recombinase reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP...cre/loxP reporter Mammalian Hescheler 12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression...Vectors Cre-containing Plasmids loxP Constructs Cre Reporters & Tools Additional Resources References Background...Fluorescent Cre: The fusion of Cre to a fluorescent reporter enables visualization of Cre expression. Optimized...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...

... which can then activate expression of a luciferase reporter in the nucleus. The Roth lab showed that ...

...pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been used for ...activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based activity reporter of SARS-CoV...method termed Specific High Sensitivity Enzymatic Reporter UnLOCKING (SHERLOCK and SHERLOCKv2). The Broad... termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has published information...(Link opens in a new window) CRISPR tools and reporters now available from Stanley Qi's lab. COVID-19 ...

...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...shRNA efficacy using fluorescence; use with pGFPns-reporter for cDNA target rtTA On Gu 60495 pSBtet-GP Sleeping...Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...

...concept, they tested a lux-mediated bioluminescence reporter in vivo in the absence of selective pressure and...Cara E., and James B. Kaper. "Use of stabilized luciferase-expressing plasmids to examine in vivo-induced...

... a YFP-tagged G protein and a NanoLuc® (Nluc) Luciferase-fused detector that specifically binds to active...6E10-A5] in Immunohistochemistry (Human). Addgene Report, doi: https://doi.org/10.57733/addgene.6ncijt.  ...

... about Mammalian Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find...

...Measure promoter strength pBV-Luc - Luciferase reporter plasmid with very low basal activity...Selectable markers Viral expression and packaging Reporters, shRNA expression, transgenics and genome... AdEasy®-1 plasmid Back to Top Reporters, shRNA expression, transgenics and genome ...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...control expression of a chemogenetic reporter ensures that the reporter remains silent until a cell or tissue-specific...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation process by a novel reporter protein... DsRed1-E5 as a reporter for mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial...Multicoloured voltage reporters (QuasAr2) Bright and fast multicoloured voltage reporters via electrochromic...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...genetically encoded calcium sensor (GECI) that reports with lifetime and intensity changes A turquoise...Calcium Ratiometric calcium biosensors from nested reporters of green- and orange-emitting proteins Ratiometric...

...elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out ...information on CRISPR check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...

...pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate ...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...