...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Link O'Connor-Giles Fly: gRNA and ssODNs...positive control: CMV-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification 1 vector system: lentiCRISPR...protocol Church gRNA design and cloning gRNA cloning vector PDF 115.2 KB Church gRNA design and cloning for...pX330) Link Parrott NEBuilder Assembly of CRISPR vectors using ssDNA oligos p201G Cas9 ; p201B Cas9 ; p201H...lentiCRISPR v2 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive...positive control: CMV-EGFP Kits are also available (mouse or human libraries) PDF 269.2 KB...

...expression vectors with various promoters suitable for in vivo expression, and/or produce vectors to make...prototrophic strains. The vectors were based on the original EasyClone vectors (Jensen et al 2013) allow...donor vectors containing mAID and either Neo or Hygro resistance markers with CRISPR/Cas vectors targeting..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They... interest and cloned into provided destination vectors using low-cost, one-pot golden gate cloning that... Jacks Lab constructed several GMAP-compatible vectors for a wide variety of biological applications. ...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ...

... Empty Vectors Many gRNA empty vectors have been deposited at Addgene. To find the gRNA vector for your... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Multiplex gRNA Vectors Several systems have been developed to generate multiplex gRNA vectors. These systems...single gRNA vectors with various promoters, plasmids for assembling multiple gRNAs into one vector, and plasmids...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...-T2A-Cas9 75348 Mammalian/Retroviral from pXL yes, activate S. pyogenes EGFP Luikart pRubiC-T2A-Cas9 75347...

...Bacterial Vectors - Includes tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial...bicistronic vector rather than a fusion protein vector) ZsGreen1-N1 - Mammalian Expression SGFP2 495 512 ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...Mammalian Retroviral Expression mCherry 587 610 16 4.5 15 min Monomer pcDNA3 mCherry LIC cloning vector (6B)...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...

... in E3 and insertion of GFP expression cassette. Bunz 179202 pAd5-B6/7 ∆E3-GFP Adenoviral A block for ...regions present in pAd5-B6 ∆E3-GFP and pAd5-B7 . Bunz 179203 pAd5-B1-deltaE1-GFP Adenoviral A block for the...production of GFP-trackable viruses containing transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal...Collection of adenovirus shuttle vectors and strains Viral...Biosafety Lentiviral Plasmids AAV Plasmids Viral Vectors 101 eBook Adenoviruses are a class of medium-sized...with large inserts Vogelstein 179201 pAd5-B6 ∆E3-GFP Adenoviral A block for the AdenoBuilder genome assembly...system. Block 1 with deletion in E1 and insertion of GFP expression cassette. Bunz 16402 pShuttle Shuttle ...

...destination vector (in this case the destination vector would be the lentiviral transfer vector). The destination...another marker, such as GFP. A researcher can use FACS to sort cells expressing GFP and later expand these...insert of interest from its parent vector and ligating into a second vector in such as way that the insert...later be digested from this new vector and cloned into the lentiviral vector. This is basically shuffling...between vectors until the gene of interest is flanked by sites compatible with those in the vector into ...site (MCS) from a separate vector into the single site in the lentiviral vector and generate more useful...by the design of the vectors and by safe laboratory practice. In terms of vector design, 2nd and 3rd generation...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse... in pBABE vectors, forward primer pBAD Forward ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli...TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript vector pBMN 5' GCTTGGATACACGCCGC...GCTTGGATACACGCCGC MMLV sequence, for inserts in pBMN retroviral vector pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin... in pcDL vector, forward primer pENTR-F CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward ...attL2 in pENTR vector, reverse primer pGEX 3' CCGGGAGCTGCATGTGTCAGAGG 3' of MCS in pGEX vectors, reverse primer...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...Douglas Kim , GENIE Project Calcium Bicistronic vector expressing GCaMP6 and mRuby2 for imaging neural... Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing...

... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1).../ARS vector (Leu2) that contains dCas9 fused to N 51025 pSLQ1661-sgMUC4-E3(F+E) Lentiviral vector that...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...anhydrotetracycline (aTc)-inducible dcas9 gene on a p15A vector with chloramphenicol resistance. The second plasmid...constitutive sgRNA expression cassette on a ColE1 vector with ampicillin resistance, wherein the N20 can...constructs 46910 pHR-SFFV-dCas9-BFP Human expression vector containing SFFV promoter, dCas9 that is fused to... 46911 pHR-SFFV-dCas9-BFP-KRAB Human expression vector containing SFFV promoter, dCas9 that is fused to...

... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...

...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...Kasparov 1732 pCPRDEnv 2nd Packaging part of the FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid... Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types...

...Commonly used cloning vectors include Gateway entry vectors and TOPO cloning vectors. If you are looking...combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant DNA molecule...specifically engineered plasmids, commonly referred to as vectors, which have become possibly the most ubiquitous...facilitate the cloning of DNA fragments. Cloning vectors tend to be very simple, often containing only a...expression (for the purposes of gene study). Expression vectors must contain a promoter sequence, a transcription...the transcription process to stop. An expression vector can also include an enhancer sequence which increases... amount of protein or RNA produced. Expression vectors can drive expression in various cell types (mammalian...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...

...format into lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included...targeting in the double digits. These multiplex gRNA vectors can be used to knock out, activate, or repress ...multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9 Endonuclease CRISPR specificity...heterogeneous population of lentiviral transfer vectors. In most cases, each plasmid contains an individual... included in the gRNA-containing plasmid, or 2-vector systems, in which Cas9 must be delivered separately...AAV backbones for in vivo experiments and in a retroviral backbone for delivery to cells that are poorly...experimental cell population (Figure 8E). In a 2-vector system, you’ll need to either co-infect with a ...