Skip to main content
Addgene
Showing: 21 - 40 of 54 results

  1. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...and the promoter of the 5’LTR has been deleted to reduce its activity. A CMV or an EF1α promoter has been...the control of two different promoters. Both the single and dual promoter transfer vectors can be used...containing the rev response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid...entry site (IRES) and expressed under the same promoter. Alternatively, your gene and the marker can be...cell cycle, a transfer vector with an inducible promoter (see below) should be used. Inducible lentiviral...Tet-response element (TRE) is placed upstream of the promoter in your transfer vector. In the absence of tetracycline...

  2. Luciferase Plasmids

    Type
    Collection
    ...Technologies from 2015 blog post. RNA Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that...fusions. Renilla luciferase under the control of a CMV promoter is present for normalization William Kaelin ...of 5' promoter/enhancer regions Joshua Mendell 60323 pGL4.23-GW Firefly Insertion of 5' promoter/enhancer...plants. Renilla luciferase under the control of a CMV promoter is present for normalization Alejandro Ferrando...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian...Renilla CMV Mammalian expression of humanized renilla luciferase Witold Filipowicz 100984 pGL4.18 CMV-Luc ...

  3. Cre-lox system

    Type
    Collection
    ...pLOX-CW-CRE Cre CMV Lentiviral Trono 12265 pHR-CMV-nlsCRE Cre CMV Lentiviral Trono 12493 p259 pCMV-CRE-M (BglII...27493 pBT140 Cre CMV Mammalian Luo 27546 pLM-CMV-R-Cre Cre and mCherry coexpression CMV Lentiviral Sadelain...Lentiviral Oka 73350 pAdx-CMV-iCre-P2A-copGFP iCre and GFP CMV Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato...Description Promoter Expression System PI 8394 p209 pCMV-cre-K Cre-K CMV Mammalian Green 8395 p210 pCMV-CREM ...pCMV-CREM CREM CMV Mammalian Green 8401 p224 pCMV-RFP/CREM floxed RFP within CREM CMV Mammalian Green 8403 p153...CREM CMV Mammalian Green 12494 p260 pCMV-CRE-M-AR(wt) CREM fused to AR ligand binding domain CMV Mammalian...split-Cre CMV Mammalian Hirrlinger 106370 pCMV-Tag2B-NCreERT2 N-terminal split-Cre-ERT2 CMV Mammalian ...

  5. Adenovirus Plasmids

    Type
    Collection
    ...containing transgene under a chosen promoter Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses...viruses containing transgene under CMV promoter Vogelstein 16404 pAdTrack Shuttle For production of GFP-trackable...containing transgene under a chosen promoter Vogelstein 16405 pAdTrack-CMV Shuttle For production of GFP-trackable...GFP-trackable viruses containing transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle...transgene under mouse cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production...pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang 50957 RedTrackCMV Shuttle...mRFP-trackable viruses containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of...

  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...vector (PGK1 promoter, 2μ) pXP316 - Yeast expression vector (TEF1 promoter, CEN/ARS) pAG304GAL-ccdB...vector (PGK1 promoter, CEN/ARS) pXP222 - Yeast expression vector (PGK1 promoter, 2μ) pAG305GAL-ccdB...information. pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...Representative Empty Backbones Promoter Measure promoter strength pBV-Luc - Luciferase ...Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG pSG5L Flag HA - Transient expression... vectors with various markers, promoters, etc pRS420 - Yeast expression ...

  7. Tetracycline Inducible Expression

    Type
    Collection
    ...Mayford 38056 pXCX.CMV.tTA Adenoviral; CMV promoter; see article for neuronal-specific promoter and enhancer...inducible promoters capable of controlling eukaryotic gene expression. Several endogenous promoters had been...Tetracycline-dependent promoters are developed by placing a TRE upstream of a minimal promoter. Tetracycline Off...bidirectional tet-responsive promoter (Pbi); Pbi contains a TRE between two minimal CMV and is silent in absence... transactivator 3 (rtTA3) expression vector, CMV promoter, and Blasticidin; can be used to make cell lines...Collections Mouse Brain Atlas of Tet-responsive Promoters Background Tetracycline Off Tetracycline On Experimental...

  8. Lentivirus Plasmids

    Type
    Collection
    ...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP...11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor... expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...with a chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid...plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...

  9. Recombinases AAV Preps

    Type
    Collection
    ...CamKII none 1, 5, 9, rg* Wilson CMV Promoter 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 6.2, 8, 9, rh10...Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson EF1a Promoter 55632 pAAV-Ef1a-mCherry-IRES-Cre...Deisseroth Cre AAV ID Name Promoter Fluorophore/Tag Serotype(s) PI CaMKII Promoter 105551 pENN.AAV.CamKII....Cepko GFAP Promoter 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson GfaABC1D Promoter 196410 AAV-GfaABC1D-Cre...Carmichael rTH Promoter 107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson PGK Promoter 24593 AAV-pgk-Cre...used to control gene expression. Dre AAV ID Name Promoter Fluorophore Serotype(s) PI 50363 AAV phSyn1(S)...DreO-bGHpA Syn none 5, rg* Zeng Flpo AAV ID Name Promoter Fluorophore Serotype(s) PI 51669 AAV phSyn1(S)...

  10. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ... gRNA from a Drosophila U6:2 promoter and Cas9 from the actin 5C promoter. Addgene’s fly library web page... over 30 promoters and 140 genes, including constructs with unique tissue-specific promoters expressing...Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA...genomic libraries are cloned downstream of a minimal promoter sequence. Should one of these random stretches...activate its own transcription from the minimal promoter and its strength can be determined from its enrichment...variety of plasmids containing many different promoters, RBS’, coding sequences (CDS), and terminators...fluorophores, generate expression vectors with various promoters suitable for in vivo expression, and/or produce...

  11. Control AAV Preps

    Type
    Collection
    ...general promoters. These AAV can be used to compare the activity of different serotypes. Promoter CAG CaMKIIa...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 1, 5, 8, 9 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10... 8, 9, rg*, PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 5, 8 Wilson...CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other Fluorophore/Tag Green Red None Other Cre-dependent...MaCPNS1 MaCPNS2 AAV9-X1.1 Clear Filters ID Name Promoter Fluorophore/Tag Activity Serotype PI Non-cre dependent...

  12. Chemogenetics Plasmids

    Type
    Collection
    ...FRT-HA-hM3D(Gq) hM3D (Gq) CMV No Roth 45548 pcDNA5/FRT-HA-hM4D(Gi) hM4D (Gi) CMV No Roth 45549 pcDNA5/FRT-HA-rM3D...) CAG mCherry Yes Sternson 52525 CMV:: HA-hM4Dnrxn hM4Dnrxn (Gi) CMV No Sternson 52523 CAG:: mCherry-2a-hM4Dnrxn...sorted, or filtered by receptor type, plasmid type, promoter, reporter or fusion protein, and whether the plasmid...) PSAM-5HT3 Inhibitory hM4D (Gi) KORD PSAM-Gly Promoter Synapsin CaMKIIa CD68 Dlx GFAP Other Reporter/...Service Available Clear Filters ID Plasmid Receptor Promoter Reporter/Fusion Cre-dependent? PI 50476 pAAV-CaMKIIa-hM3D...FRT-HA-rM3D(Gs) rM3D (Gs) CMV No Roth 70717 AAV-mOXT-hM3Dq-mCherry-WPRE hM3D (Gq) Mouse Oxycotin mCherry...

  13. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... DCTN1 CMV ALS Trina Schroer 51221 CMV-CC2 DCTN1 CMV ALS Trina Schroer 51412 CMV-p150 DCTN1 CMV ALS Trina...Yeast Other Promoter CMV T7 polH GAL Other Clear Filters ID Plasmid Name Gene Tags Promoter Disease PI ...hATMS1981A ATM His, Flag CMV Ataxia telangiectasia Michael Kastan 32813 CMV-hEAAT1 SLC1A3 CMV Episodic ataxia ...moPrP(3F4) D177N PRNP CMV Dementia Susan Lindquist 1321 cytosolic moPrP (3F4) PRNP CMV Dementia Susan Lindquist...FLAG-hPLIC-2 UBQLN2 Flag CMV ALS Peter Howley 8662 p4456 FLAG-hPLIC-2 NTF UBQLN2 Flag CMV ALS Peter Howley 10880...DNMT1 GFP CMV Hereditary sensory neuropathy type IE Tyler Jacks 12166 pSicoR Dnmt1 DNMT1 GFP CMV Hereditary...PINK1 Myc CMV Parkinson's Mark Cookson 13315 pcDNA-DEST53 PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson...

  14. TALEN Expression Vectors

    Type
    Collection
    ...listed below have the CMV promoter for mammalian cell expression and a T7 promoter for in vitro transcription...

  15. CRISPR-Cas/RGN expression plasmids for human cells

    Type
    Collection
    ...listed below ( MLM3639 and JDS246 ) harbor a CMV promoter that drives expression of a transcript encoding...vectors express a customized guide RNA from a U6 promoter. Individual plasmids can be ordered via the links...

  16. Lentiviral Prep Service

    Type
    Collection
    ...pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter, Hygro...Cas9 protein and blasticidin resistance from EFS promoter. Lentiviral backbone. Zhang Cas9 and Accessories...

  17. Qi Lab CRISPR Page

    Type
    Collection
    ...retroVirus LTR promoter. The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled ...vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter 46916 pU6-sgGAL4-4 Human pSico-based...vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control) 46918 pU6...contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1 promoter 46923 pSNR52-sgTET Yeast CEN...controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoter... the genome. The pgRNA_humanized also contains a CMV-puro-t2A-mCherry expression cassette, useful for ...pHR-SFFV-dCas9-BFP Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP 46911...

  18. Zhang Lab CRISPR Page

    Type
    Collection
    ... sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven SpCas9; for neuronal...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be digested...codon-optimized SpCas9, driven by the truncated MeCP2 promoter (pAAV-pMecp2-SpCas9-spA) for expressing Cas9 in...

  19. Mammalian RNAi Tools

    Type
    Collection
    ... pLL3.7 Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector...pLVCT-tTR-KRAB 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...2SM2 2nd generation; Transgene (CAG promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hEF-1alpha promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick... 2nd generation; Transgene (hPGK promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) Off Patrick...generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned from pLVTHM) On Patrick...

  20. Sequencing Primers

    Type
    Guide
    ...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...
Showing: 21 - 40 of 54 results