Skip to main content
Addgene
Showing: 21 - 40 of 68 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ...Technologies from 2015 blog post. RNA Biology CMV-LUC2CP/intron/ARE, CMV-LUC2CP/ARE : A splicing reporter that...luciferase Eric Campeau 21474 pLenti CMV V5-LUC Blast (w567-1) Firefly CMV Lentiviral expression of firefly...Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai 87121 pcDNA-RLuc8 Renilla CMV Mammalian...Renilla CMV Mammalian expression of humanized renilla luciferase Witold Filipowicz 100984 pGL4.18 CMV-Luc ...William Hahn, David Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase...firefly luciferase Mark Kay 105532 pAAV.CMV.ffLuciferase.SV40 Firefly CMV AAV expression of firefly luciferase...Venus-firefly luciferase Roland Friedel 170575 pCMV-FLuc Firefly CMV Retroviral expression of firefly luciferase...
  2. Adenovirus Plasmids

    Type
    Collection
    ...Vogelstein 16403 pShuttle-CMV Shuttle For production of viruses containing transgene under CMV promoter Vogelstein... pAdTrack-CMV Shuttle For production of GFP-trackable viruses containing transgene under CMV promoter ...pShuttle-CMV plasmid with Gateway cassette; See article for additional plasmids Zhang 50957 RedTrackCMV Shuttle...mRFP-trackable viruses containing transgene under CMV Bamburg 50958 ShuttleNSE Shuttle For production of...mouse cofilin promoter (MCP) Bamburg 62621 pShuttle-CMV-F2A-T2A-Venus Shuttle For production of viruses with...
  3. MXS Chaining

    Type
    Blog Post
    ...structures (Table 1). Each construct was flanked with a CMV promoter (to drive high-level expression) and a polyA...
  4. Plasmids 101: Gateway Cloning

    Type
    Blog Post
    ...lentiviral expression, we could use a vector like pLenti CMV Puro DEST (w118-1) or the doxycycline-inducible pLIX...
  5. Lentivirus Plasmids

    Type
    Collection
    ...coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP... expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...pLL3.7 3rd Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression... added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression...plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive...for more variations. Campeau 39481 pLenti-puro 3rd CMV driven expression of cDNA. Puro selection. Shih 25737...puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for CMV driven expression of cDNA. See article for alternative...
  6. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...information. pAdTrack-CMV - Shuttle vector for transgene expression under a CMV ...Promoters Representative Empty Backbones Mammalian CMV, SV40, EF1a, CAG pSG5L Flag HA - Transient ...Tet-inducible lentiviral shRNA expression pLenti CMV Neo DEST - Lentiviral Gateway destination...Retroviral shRNA expression pLenti CMV Puro DEST - Lentiviral Gateway destination...Tet-inducible lentiviral shRNA expression pLenti CMV Hygro DEST - Lentiviral Gateway destination...vector for gene expression pLenti CMV/TO Hygro - Lentiviral Gateway destination...destination for shRNA expression pLenti CMV/TO Zeo DEST - Tet-inducible lentiviral...
  7. Retrovirus Plasmids

    Type
    Collection
    ...and env Verma 35614 pBS-CMV-gagpol Packaging MoMLV gag and pol Salmon 8454 pCMV-VSV-G Envelope Envelope... Puro resistance. Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A ...Cre fusion in mammalian cells Foijer 47916 pRXTN CMV/MSV pRXTN is a modified version of pRX-tight Puro...containing retroviral plasmid Vignali 27995 TtRMPVIR CMV/MSV Tet-regulated expression of shRNA; expresses ...additional plasmids in this toolkit. Lowe 64865 pLncEXP CMV/MSV lncRNA expression plasmid Sun 60683 pLXIN-Luc...
  8. Tetracycline Inducible Expression

    Type
    Collection
    ... and fos 3'UTR tTA Off Mayford 38056 pXCX.CMV.tTA Adenoviral; CMV promoter; see article for neuronal-specific...promoter (Pbi); Pbi contains a TRE between two minimal CMV and is silent in absence of binding of tTA or rtTA...Plasmid Description Element On or off PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral reverse tetracycline-controlled...tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV promoter, and Blasticidin; can be used to make cell...generation rtTA On Campeau 25434 pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion...
  9. Control AAV Preps

    Type
    Collection
    ...105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase...Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10... 5, 8, rg*, PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson...CAP-B22 MaCPNS1 MaCPNS2 AAV9-X1.1 Promoter CAG CaMKIIa CMV Dlx EF1a/nEF GFAP and variants Synapsin TBG Other...
  10. Recombinases AAV Preps

    Type
    Collection
    ...Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre EF1a mCherry (not a fusion tag)...
  11. Lentiviral Prep Service

    Type
    Collection
    ...17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV promoter,...
  12. Sequencing Primers

    Type
    Guide
    ... Commonly Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward primer Luc-F AGTCAAGTAACAACCGCGA...MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer...
  13. TALEN Expression Vectors

    Type
    Collection
    ...same). All expression vectors listed below have the CMV promoter for mammalian cell expression and a T7 promoter...
  14. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Magneto2.0 Gateway 74307 pAAV-CMV-DIO-Magneto2.0-sNRPpA AAV 74306 pAAV-CMV-DIO-TRPV4-p2A-ferritin-sNRPpA...
  15. Zhang Lab CRISPR Page

    Type
    Collection
    ...Available plasmids are described below: 61591 : PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven...TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600; CMV-driven SaCas9 60957 : PX551; Truncated MeCP2 promoter-driven...driven by either the ubiquitous cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding...
  16. CRISPR References and Information

    Type
    Collection
    ...packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF 2.3 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Kits are also available (mouse or human libraries...
Showing: 21 - 40 of 68 results