Skip to main content
Addgene
Showing: 21 - 40 of 110 results

  1. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...called BLESS (direct in situ breaks labeling, enrichment on streptavidin and next-generation sequencing.../biot.201400046  Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L, Makarova KS, Koonin ...

  2. Plasmids 101: Broad Host Range Plasmids

    Type
    Blog Post
    ...RK2 (IncP), RSF1010 (IncQ), and pSa (IncW)  (Schmidhauser et al. 1988; Lale et al 2011; Jain and Srivastava... 326–332. https://doi.org/10.1002/bit.22695  Schmidhauser, T. J., Ditta, G., & Helinski, D. R. (1988)....

  3. Hot Plasmids - November 2023

    Type
    Blog Post
    ...one enzyme’s substrate, then the other, a dual-enrichment and mass spectrometry workflow identifies proteins...and APEX2 at different cellular locations. C) Enrichment of dual-labeled proteins identifies proteins ...

  4. Plasmids 101: Codon usage bias

    Type
    Blog Post
    ...regions a chance to fold properly. For example Pechmann and Frydman found that tracts of non-optimal codons...20506237. PubMed Central PMCID: PMC2970903. 6. Pechmann, Sebastian, and Judith Frydman. "Evolutionary ...

  5. New CRISPR Tools: Cas7-11 and PASTE

    Type
    Blog Post
    ... cells. Moreover, they optimized the specific attachment sites via sequence engineering, enabling even...Eleonora I. Ioannidi, Matthew T. N. Yarnall, Cian Schmitt-Ulms, Rohan N. Krajeski, Justin Lim, Lukas Villiger...

  7. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...Plasmids 101: Aptamer Fluorophores describes the enrichment process used to evaluate oligonucleotides for...systematic evolution of ligands by exponential enrichment (SELEX). After 4-6 rounds of SELEX, the RNA pool...

  8. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...Charoensawan V, Adryan B, Thisse B, Thisse C, Teichmann S and Wright GJ Molecular & cellular proteomics...GJ. Genome research 2008 Apr; 18(4):622-30. A benchmarked protein microarray-based platform for the identification...

  9. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...Plasmid #67178) for use in the system outlined in Schmid-Burgk, J.L., et al (2). In this post, I’ll cover... 22894855. PubMed Central PMCID: PMC3501149. 2. Schmid, J.L., et al. (2016) CRISPaint allows modular base-specific...

  11. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ... or fluorescent molecules such as Fluoro-Gold (Schmued and Fallon, 1986) are used. To facilitate cellular...PMID: 22418061. PubMed Central PMCID: PMC3381869. Schmued L.C., and Fallon J.H. (1986). Fluoro-Gold: a new...

  12. Immunology Research Plasmids and Resources

    Type
    Collection
    ...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LTB4R leukotriene B4 receptor BLT1, BLTR, CMKRL1...leukocyte cell-derived chemotaxin 2 MGC126628, chm-II, chm2 LEFTY1 left-right determination factor 1 LEFTB...PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS,...

  13. Validated gRNA Sequences

    Type
    Collection
    ...25490046 Schmitt-Ulms Prnp M. musculus TTGGCCCCATCCACCGCCAT 61856 cut S. pyogenes 25490046 Schmitt-Ulms Pten...

  14. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...CRISPR Knockout Library 104861 Knockout Mouse Teichmann N/A (retroviral) 5 90,230 RNA-Binding Protein ...
Showing: 21 - 40 of 110 results