...library containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP...second plasmid containing the homology arms and an N- or C-terminal tag. The two PCR reactions are then...stably expressing Cas9. This PCR toolkit offers C- and N-terminal tagging vectors (eg GFP, Flag, YFP, Strep...

...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145 Mammalian hU6 yes, cut (enhanced) S. pyogenes EGFP Zou pRS416gT-GalL-Cas9...Mammalian U6 yes, cut N. meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1 64116 Mammalian/Lentiviral U6 none N. meningitidis...Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1 64118 Mammalian/Lentiviral U6 none N. meningitidis...cut N. meningitidis Joung Cas9 sgRNA vector 68463 Mammalian U6 none S. pyogenes Zhang Cas9/pTREX-n 68708...interfere, or nick. Selection , such as Puromycin or EGFP Cloning enzyme used for insertion of your gRNA sequence...

... nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical.... Pubmed. H.-U. Dodt, U. Leischner, A. Schierloh, N. Jährling, C.P. Mauch,  K. Deininger, et al. (2007...Medicine, 18, 166–171. Pubmed. A. Ertürk, K. Becker, N. Jährlin, C.P. Mauch, C.D. Hojer, J.G. Egen, F. Hellal...

...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...23792628 Joung EGFP A. victoria GGAGCGCACCATCTTCTTCA 51763 cut S. pyogenes 24336571 Zhang EGFP A. victoria...24336571 Zhang EGFP A. victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria...23918387 Chen EGFP A. victoria GGGCACGGGCAGCTTGCCGG 47511 cut S. pyogenes 23792628 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...26918244 Lu PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana...

...provided detailed protocols for N- or C-terminal tagging in Drosophila cells. N terminal tagging in Drosophila...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...Doyon's lab deposited a plasmid which introduces an N- or C- terminal affinity tag (3xFLAG-2xSTREP) on endogenous...

...pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1...14121 pcDNA3-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP...Dantuma 23971 VCP(wt)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23972 VCP(R155H)-EGFP VCP His, GFP, HA CMV...Dantuma 23973 VCP(A232E)-EGFP VCP His, GFP, HA CMV ALS Nico Dantuma 23974 VCP(DK0)-EGFP VCP His, GFP, HA CMV...Merrifield 28195 tdp43-EGFP construct2 TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP...Zuoshang Xu 28197 tdp43-EGFP construct4 TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP...Zuoshang Xu 28199 tdp43-EGFP construct6 TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP...

...Plasmid Name Tags 69090 pMJ915 MBP (N terminal); 6xHis (N terminal); 2xNLS (C terminal) 47327 ...commonly used cassettes, such as fluorescent proteins (EGFP, mCherry etc.), recombinases (Cre, Flp etc.), and...62934 pET-NLS-Cas9-6xHis 6xHis (C terminal); NLS (N terminal)   Easi-CRISPR efficiency and delivery...

...pET Flag TEV - N-terminal Flag-TEV for bacterial expression pCS2FLAG - N or C-terminal ...Epitope Tag pKH3 - N or C-terminal 3xHA tag for mammalian expression pHAHA - N-terminal double...pEBG - N-terminal GST for mammalian expression pET His6 GST TEV - N-terminal...pDest-565 - N-terminal His6-GST for bacterial expression (Gateway) pPS892 - N-terminal GST...pWPXL - Lentiviral expression pBI-MCS-EGFP - Tet-inducible Transient ...for C elegans expression GFP Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression... Flag Epitope tag pcDNA3 Flag HA - N-terminal Flag-HA for mammalian expression pNIC-CTHF...

... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...) and single guide RNA 48140 : PX461; SpCas9n-2A-EGFP (D10A nickase) and single guide RNA 62987 : PX462...20bp). #60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP...contains two expression cassettes, Cre recombinase-2A-EGFP-KASH and an sgRNA backbone for cloning new targeted...

...pSLQ1658-dCas9-EGFP Human expression vector containing dCas9 that is fused to 2x NLS and EGFP for CRISPR ...targeting endogenous CD71 gene 46919 pMLS-SV40-EGFP Target EGFP gene that is stably integrated into HEK293...Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman...CEN/ARS vector (Leu2) that contains dCas9 fused to N 51025 pSLQ1661-sgMUC4-E3(F+E) Lentiviral vector that...

...lentiviruses delivering 1) a BioTAP-tagged dCas9 and an eGFP tag, and 2) gRNAs Number of loci targeted One ....2017.08.003 Liu, X., Chen, Y., Zhang, Y., Liu, Y., Liu, N., Botten, G.A., Cao, H., Orkin, S.H., Zhang, M.Q.,...

...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...none 1, 5, 8, 9, rg* Engel , Nectow 69570 pAAV-EF1a-N-CretrcintG EF1a none 1 Cepko 69571 pAAV-EF1a-C-CreintG...

...32 amino acid linker mGFP-10-sREACh-N3 Monomeric EGFP attached to super-REACh via a 10 amino acid linker...pPROEX Aqua Cyan Bacterial Expresses Aquamarine with N-terminal His tag pAquaN1 Cyan Mammalian Expresses ...Mammalian Express a gene of interest fused to the N-terminus of monomeric Cerulean mCerulean C1 Cyan Mammalian...Mammalian Express a gene of interest fused to the N-terminus of Amber Amber C1 Yellow Mammalian Express...Mammalian Express a gene of interest fused to the N-terminus of monomeric Venus mVenus C1 Yellow Mammalian...Mammalian Express a gene of interest fused to the N-terminus of LSSmOrange pLSSmOrange-C1 Orange Mammalian...

... A. R., Shin, N., Kim, Y., Toong, N., Kaplow, I. M., Wirthlin, M., Zhang, X., Phan, B. N., Fox, G. A.,...s41467-023-38582-7 Chuapoco, M. R., Flytzanis, N. C., Goeden, N., Christopher Octeau, J., Roxas, K. M., Chan.../10.1038/nbt.3440 Goertsen, D., Flytzanis, N. C., Goeden, N., Chuapoco, M. R., Cummins, A., Chen, Y., ...10.1038/s41593-021-00969-4 Goertsen, D., Goeden, N., Flytzanis, N. C., & Gradinaru, V. (2022). Targeting the...Radaelli, C., Gore, B. B., Weed, N., Omstead, V., Bishaw, Y., Shapovalova, N. V., Martinez, R. A., Fong, O...relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the brain.... AAV9.452sub.LUNG1 Lung: ATII cells Mice N/A Goertsen et al., 2022 AAV.CAP-B22 CNS: neurons...

...mEmerald-pBAD - Bacterial Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP...Citrine, and eGFP pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal...Expression pLV-eGFP - Mammalian Lentiviral Expression Ac5-STABLE1-neo - Insect Expression pCS2+8CeGFP - Zebrafish...urchin pCS2+8NeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin pKT0128 - Yeast Expression EGFP-pBAD - Bacterial...Expression cfSGFP2 493 517 34 5.4 Monomer (A206K) cfSGFP2-N - Mammalian Expression (cysteine-free SGFP2) ZsGreen...5.4 35 min Prone to dimerization pcDNA3-mNeptune2-N - Mammalian Expression mNeptune2 600 650 21 Prone ..., mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal fluorescent proteins Insect Sutherland...

...incorporates the highly photostable fluorophores mOrange2, EGFP, and mKate2 (red) to solve the problematically low... 59.3 (2018): 1630-1640. Sakaguchi, Richi, Marcus N. Leiwe, and Takeshi Imai. "Bright multicolor labeling...

...Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector to monitor...Plasmid Description PI 11578 pSico Cre addition causes EGFP to be recombined out of the construct, activating...Tyler Jacks 11579 pSicoR Cre addition causes both EGFP and shRNA to be recombined out of the construct,...Carpenter AE, Foo SY, Stewart SA, Stockwell BR, Hacohen N, Hahn WC, Lander ES, Sabatini DM, Root DE. Cell. 2006...

...16542 pBI-MCS-EGFP Expression of your gene of interest (MCS with a β-globin poly A) & EGFP from a bidirectional...pTet-IRES-EGFP Lentiviral plasmid for inducible expression of transgene of interest and EGFP None Either...pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion; pMA2641 has rtTA driven by retroviral...with minimized background expression. Loew R, Heinz N, Hampf M, Bujard H, Gossen M. BMC Biotechnol . 2010...

...sequence in between two fragments of EGFP in pCAG-EGxxFP. The EGFP fragments contain 482bp of overlapping...The pCoofy series of plasmids contain a variety of N- and C-terminal tags (including His, S-tag, OneStrep...types of pre-cloned insert modules (plant promoter, N-terminal tag, coding sequence of the gene of interest...

...: 25184501. PubMed Central PMCID: PMC4262738. 3. EGFP gRNA (BRDN0000561167) (Plasmid #80034) and BRAF ...off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith...