... requires selection. These two steps are (Figure 1): The initial plasmid integration step (the so-called...antibiotic resistance marker from the vector (abR, Figure 1). The resolution step (“double crossover”) which leads... loss of a specific phenotype (using sacB, Figure 1, further discussed below).  Counter-selectable marker...Current protocols in molecular biology 106.1 (2014): 1-16. PubMed PMID: 24733238. Additional resources on...tested their expression under both rhamnose- and arabinose-inducible promoters. Tight control of toxin expression...though Khetrapal et al. also demonstrated that the arabinose promoter worked too. Rhamnose induction relies...

...Cascade's complexity. Figure 1: Schematic of Class 1 CRISPR types. Class 1 includes type I with a Cas3 ...collection! A “complex” system Cas3 is part of the Class 1 CRISPR family, which means it requires multiple Cas...the brunt of the mechanical work for editing. Class 1 CRISPR systems make up the majority of CRISPR-based...CRISPR-based immune systems in bacteria and archaea. Class 1 is further broken down into different types, with ...making up type I, the most abundant type in the Class 1 category. These type Is can then be further broken...editing in human cells. Nature Communications, 10(1). https://doi.org/10.1038/s41467-019-13226-x Cameron...been challenging. It can be difficult to ensure comparable expression of all components of Cascade for maximum...

...recombineering system has three components (Figure 1): 1) Exo, 2) Beta, and 3) Gam. All three are required...from the 5’ end and generate 2 possible products: 1) a partially dsDNA duplex with single-stranded 3’ ...recombineering with an ssDNA oligo substrate.   Figure 1: Components of the Lambda Red Recombineering system...and tags.  The typical frequency of recombinants is 1 positive clone out of 104 to 105 colonies. Pro Tip...dsDNA with a recombination frequency between 0.1% to 1%, and can be increased to as high as 25-50% by designing...replication. There are two ways to avoid activating MMR: 1) use a strain of bacteria that has key MMR proteins...or 2) specially design ssDNA oligos to avoid MMR: 1) E. coli with inactivated MMR: Using E. coli with ...

...recombinase-based state machines in living cells” (1), into a more straight-forward, concise explanation...an RSM is to sequence the register. In our paper (1), we allowed individual bacterial cells to form colonies...in the Materials and Methods section of our paper (1). Lastly, it is possible to build gene regulatory ... not. How might one implement RSMs? In our study (1), we implement RSMs in E. coli with two plasmids (...inputs to endogenous gene expression (2). Our paper (1) explains how to arrange attB-attP pairs on a register...performance data from the indicated figures in our paper (1)) Input Plasmid Output Plasmid Fig. 3A pNR64 pNR160...in the Material and methods section of our paper (1). How might one troubleshoot GSRMs that don't work...

... Then plasmids are cured from the cell. Steps 1-1 and 1-2 can be done simultaneously. Image from Li et...coli K-12 strains, 2 E. coli B strains, 1 E. coli W strain, and 1 Tatumella citrea, with a total of 70 sites... update the pCas/pTargetF system.   Figure 1: The editing process begins with the addition of the...updates involved the following changes. In pCas9, we 1) replaced the promoter of gRNA-pMB1 with PrhaB, 2)...biosynthesis, we constructed a strain library with 1-11 copies of integrated genes. We obtained a stable...temperature-sensitive replicon for self-curing, an arabinose inducible lambda-red gene, and an IPTG-inducible...

...deletions, point mutations PCR Reactions 1 1 1 per fragment 1 per fragment In vitro Assembly No No Yes...methods for site directed mutagenesis   References 1. Trehan, Ashutosh, et al. (2016). “REPLACR-mutagenesis...phage recombination machinery is induced using L-arabinose. These cells can be made and frozen in large batches...

...also important for social and regulatory reasons. 1.) The transposon consists of a mirrored set of inverted...vertebrates. The system is comprised of 2 components: 1) an SB transposase, the enzyme required for catalysis...likely to grow in the coming decades.  References 1. Kowarz E, et al. Optimized Sleeping Beauty transposons...T cells to target CD19. Immunol Rev. 2014 Jan;257(1):181-90. doi: 10.1111/imr.12137. PubMed. Find the ...efficiencies of stable gene transfer using SB100x were comparable to stable transduction efficiencies of integrating...

...near-perfect physical-to-infectious particle ratio of 1:1 (Zeltner et al., 2010). However, for recombinant ...preparations are genome-containing (Figure 1).    Figure 1: Electron micrograph of an Addgene AAV...reported a physical-to-infectious particle ratio of 50:1 (Zeltner et al., 2010). The specific infectivity of... lot (if we still have it available). References 1. Fagone, Paolo, et al. "Systemic errors in quantitative... Human Gene Therapy, Part B: Methods 23.1 (2011): 1-7. PubMed PMID: 22428975. PubMed Central PMCID: PMC3640491...individual sample, this will reduce convenience and comparability because each sample with be quantified with ...

...premature chain termination 1-10 ug/mL Zeocin Sh bla HeLa, NIH3T3, CHO, COS-1, 293HEK, Jurkat T cells Complexes...expressing the Epstein–Barr virus (EBV) nuclear antigen 1 (EBNA1) or the SV40 large-T antigen (293E or 293T ...Concentation*** Blasticidin bsd  HeLa, NIH3T3, CHO, COS-1, 293HEK Inhibits termination step of translation ...called transfection. Transfection is somewhat comparable to bacterial transformation (the introduction...

...occasionally less than 1%, and virtually never exceeds 40%. While this is comparable or better than the efficiency...infection, gene targeting vectors with relatively short (1 kb) homology arms underwent homologous recombination...sequences of interest to cells with efficiencies of 1-40% after G418 selection (Kohli et al 2004, Kim et...with polylinkers for the addition of gene-specific 1 kb homology arms flanking a FLOXed neoR gene. pAAV-SEPT-Acceptor...since it routinely generates knockin efficiencies of 1-40% with G418-selected clones. However, there are ...gene inactivation in human cancer.     References 1. Russell, David W., and Roll K. Hirata. "Human gene...

...guide for a refresher on CRISPR/Cas9.  Figure 1: Cpf1 is a single RNA-guided endonuclease of a class... than the multi-subunit complex employed by class 1 systems. A putative new class 2 nuclease, Cpf1 (CRISPR...that Cpf1 can tolerate mismatches at gRNA positions 1, 8, 9, and 19-23. Accordingly, the 3’ end of the gRNA...Most gRNAs directed low-frequency Cpf1 cleavage at 1-12 off-target sites; in contrast, SpCas9 may cleave...the diversity of CRISPR-based systems. References 1. Zetsche, Bernd, et al. "Cpf1 is a single RNA-guided...lower than that of the widely used SpCas9 and comparable to SaCas9. As seen with Cas9 orthologs, Cpf1 ...

...C2c1, C2c2 and C2c3 (short for Class 2, candidate 1, 2, or 3). C2c1 and C2c3 are related to Cpf1, but ...lacks the ability to cleave the RNA target.  Table 1: Comparison on Common CRISPR Enzymes Name  Enzymatic...Blog Posts Applications of Cas13a   Figure 1: Using Cas13a as a diagnostic tool. A pool of DNA ... This system, dubbed SHERLOCK (depicted in figure 1) has been used to differentiate strains of Zika virus...contributed to the update of this post. References 1. Abudayyeh, Omar O., et al. "C2c2 is a single-component...multiplexing; expressing 5 gRNAs simultaneously produces comparable gene knockdown to single gRNA expression. Although...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ...Blue-light–mediated induction of protein interactions based on Arabidopsis thaliana cryptochrome 2 and CIB1 450 LARIAT Inhibits...OPTOSTIM PHR domain2 of cryptochrome 2 (Cry2) from Arabidopsis thaliana is fused to truncated forms of cytosolic...

... hybridization experiments. A recent publication [1] from the Sánchez lab describes the plasmids and protocols...deposit) are described in the Sánchez lab publication [1] so that the students performing these experiments...can easily investigate in planarians. References 1. Alice Accorsi, Monique M. Williams, Eric J. Ross,...Proceedings of the National Academy of Sciences 100.suppl 1 (2003): 11861-11865. PubMed PMID: 12917490. PubMed...PMC304099. Additional Resources on the Addgene Blog Arabidopsis in Education Learning Synthetic Biology with ...

...on-target and off-target editing efficiency Figure 1: Effects of (A) double and (B) single base pair gRNA-target...that Cpf1 can tolerate mismatches at gRNA positions 1, 8, 9, and 19-23. Accordingly, the 3’ end of the gRNA...Most gRNAs directed low-frequency Cpf1 cleavage at 1-12 off-target sites; in contrast, SpCas9 may cleave...fits into the genome editing landscape. References 1. Kim D, Kim J, Hur JK, Been KW, Yoon SH, Kim JS. Genome-wide...lower than that of the widely used SpCas9 and comparable to SaCas9. As seen with Cas9 orthologs, Cpf1 ...

...much more favorable than previous methods yielding 1-10% knock-in. Read on to learn how you can make CRISPR...one NHEJ-repaired indel, often occur. Figure 1: In conventional gene targeting (A), you must first... drug induction systems (ttA or rtTA) are between 1 to 2 kb in length. There are plenty of Addgene plasmid...CRISPR ribonucleoproteins.” Genome Biol. 18 (2017) (1):92. DOI: 10.1186/s13059-017-1220-4 PubMed PMID: 28511701... using long ssDNA donors.” Nat Protoc. 13 (2018) (1):195-215. DOI: 10.1038/nprot.2017.153 PubMed PMID:...engineering using CRISPR nucleases. Genome Biol. 19 (2018) (1):25. DOI: 10.1186/s13059-018-1400-x PubMed PMID: 29482575...efficiency using a small ssDNA, and they found comparable efficiencies (52 vs 49%). In contrast, Easi-CRISPR...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer pBAD Reverse GATTTAATCTGTATCAGG...GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer pBluescriptKS TCGAGGTCGACGGTATC...

...overlap with the negative control population (Figure 1). Based on where the GFP- population ends, you can...total cells present in the gate.   Figure 1: Example of yes-no flow plot of the (negative) control...for a yes-no dot plot, like the one shown in Figure 1.  Figure 3: An example of a histogram plot ...with the baseline suggesting this sample has a comparable expression to the baseline/negative control. ...

...include mEGFP, mCherry, and HaloTag. Figure 1: (a) Anti-FLAG frankenbody (FB) construction from ...Comm. 2019. https://doi.org/10.1038/s41467-019-10846-1.   Optimized genetic screening technique using Cas12a... to Cas9’s larger expression requirements (Figure 1), but Cas12a has generally been underutilized in genetic...or Cas12a. Despite its small size, CasMINI is comparable in efficacy to dCas12a systems in both gene activation...

...Transposons: The jumping genes. Nature Education 1(1):204. https://www.nature.com/scitable/topicpage/transposons-the-jumping-genes... They transpose by a ‘copy-paste’ mechanism (Fig. 1). They first copy themselves as RNA transcripts and...their host’s genome.   There are two types of Class 1 TEs: those with long terminal repeats (LTRs) and those...reverse transcriptase activities.    Figure 1: Overview of retrotransposon transposition. Retrotransposons...CRISPR-Cas system. This system has four major components: 1) a CRISPR RNA (crRNA), 2) four proteins (TniQ, Cas8...another. This jumping is what caught the eye of Barabara McClinntock who first discovered transposons due...