Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 21 - 28 of 28 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...DKFZp434G0625, DKFZp566O0546, FAYV2820, FLJ35026, FLJ38287, KIAA1550, PLEXA4, PLXNA4A, PLXNA4B, PRO34003 ...EP3) EP3, EP3-I, EP3-II, EP3-III, EP3-IV, EP3e, MGC141828, MGC141829, MGC27302 PTGER4 prostaglandin E receptor...homolog B1 B-RAF1, BRAF1, FLJ95109, MGC126806, MGC138284, RAFB1 CASP3 caspase 3, apoptosis-related cysteine...TCRGV8, V1S8 TRGV9 T cell receptor gamma variable 9 MGC47828, TCRGV9, V2 VAV1 vav 1 guanine nucleotide exchange...
  2. Validated gRNA Sequences

    Type
    Collection
    ...Sabatini BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation S. pyogenes 26969735 Zoldoš Non-targeting...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...21827 TLS 1: hTLS.pBSKS(+) FUS T7 ALS David Ron 21828 TLS 2: hTLS.pCDNA1 FUS CMV ALS David Ron 21829 TLS...TDP43 RRM-GFP N345K TARDBP CMV ALS Rajat Rohatgi 107828 pHBS1278 TDP43 RRM-GFP N345R TARDBP CMV ALS Rajat...
  4. CRISPR Guide

    Type
    Collection
    ...S, Kim JS. Nat Commun . Aug 6;9(1):3048. PMID: 30082838 Engineered anti-CRISPR proteins for optogenetic...
  5. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...anti-Gephyrin nanobody GS8 Gephyrin Human Llama 145828 GS41 pComb3xss anti-Gephyrin nanobody GS41 Gephyrin...
  6. CRISPR Guide

    Type
    Guide
    ...S, Kim JS. Nat Commun . Aug 6;9(1):3048. PMID: 30082838 Engineered anti-CRISPR proteins for optogenetic...
Showing: 21 - 28 of 28 results