...Methods Mol Biol, 498 (2009): 185–196. PubMed PMID: 18988027. PubMed Central PMCID: PMC3223083. 6. McInnes,...

...system." Cell 155.7 (2013): 1479-1491. PubMed PMID: 24360272. PubMed Central PMCID: PMC3918502.  14. Chernov...

... Commun 9: . https://doi.org/10.1038/s41467-017-02706-7 Wang H, Yang H, Shivalila CS, Dawlaty MM, Cheng...

...(TrypLE, Thermo Fisher, 12605010) Ethanol, VWR, EX0276-1 Benzonase 250 U/µl, Millipore #71205-3 Polybrene...

...nucleases." Molecular Therapy (2015). PubMed PMID: 26502778. 13. Frock, Richard L., et al. "Genome-wide detection...

...research. Nature 518:27–9. https://doi.org/10.1038/518027a  Roncador G, Engel P, Maestre L, Anderson AP, Cordell...

... PubMed PMID: 20161833. PubMed Central PMCID: PMC2802762. 2. Dumas, Anaëlle, et al. "Designing logical...

.... Nat Med, 2000. 6(5): p. 568-72. PubMed PMID: 10802714. 41. Vierbuchen, T., et al., Direct conversion...

...Development. 2020 Jul 3;147(13). pii: dev.190272. doi: 10.1242/dev.190272. PMID 32541005...

...GTGGCGTGACCTGTGGATGCTG 51025 visualize S. pyogenes 24360272 Qi MYOD1 H. sapiens TGGCCTCCCTCCCTGCCCGGTAG 64138...GTTAGGGTTAGGGTTAGGGTTA 51024 visualize S. pyogenes 24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313...

... Yeast Ingolia NA ~6 44,580 KSHV Tiling Library 180272 Knockout KSHV Glaunsinger NA NA 24,000 BLaER1 pgRNA...

...VLPs loaded with CRE protein CMV Mammalian Ohlmann 120279 014LP-pAAV-ANF-657- Cre-pA Cre; for atrial-specific...Electroporation. Proc Natl Acad Sci. Jan 16;104(3):1027-32. doi: 10.1073/pnas.0610155104. Epub 2007 Jan ...

...TAL022 32265 TAL024 32266 TAL025 32267 TAL026 32268 TAL027 32269 TAL029 32270 TAL030 32271 TAL031 32272 TAL032...

...prosome, macropain) 26S subunit, non-ATPase, 13 HSPC027, Rpn9, S11, p40.5 PSMD14 proteasome (prosome, macropain...-X-C motif) ligand 11 H174, I-TAC, IP-9, IP9, MGC102770, SCYB11, SCYB9B, b-R1 CXCL12 chemokine (C-X-C ...alpha FLJ00280, FLJ00318, FLJ16020, FLJ16733, MGC102720, NR2B1 RXRB retinoid X receptor, beta DAUDI6, ...

...Kellner MJ, Joung J, Zhang F. Science . 358(6366):1019-1027. PMID: 29070703 RNA targeting with CRISPR-Cas13...., Qi LS, Huang B. Cell . 155(7):1479-91. PMID: 24360272 Efficient isolation of specific genomic regions...

...Left TAL2026 TCAGCCGCTACCC eGFP-TALEN-14-Right TAL2027 TGAAGAAGTCGTG eGFP-TALEN-15-Left TAL2028 TCTTCAAGTCCGC...

...-bio-His 52025 CD36-bio-His 52026 ARMET-bio-His 52027 CCL5-bio-His 52028 CTGF-bio-His 52029 FGA-bio-His...

...Kellner MJ, Joung J, Zhang F. Science . 358(6366):1019-1027. PMID: 29070703 RNA targeting with CRISPR-Cas13...., Qi LS, Huang B. Cell . 155(7):1479-91. PMID: 24360272 Efficient isolation of specific genomic regions...

...TGCCAGGCTCGTAGCCTGttccaggctgatgccccTCAGCCCAGATGGGAGGA arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA...

...red-shifted) oScarlet Cre dependent 8 Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR...