...has used an inducible MitoTimer reporter using a Tet-on system (pTRE-Tight-MitoTimer) to show its usefulness...repressor plasmids from Scot Wolfe's lab. These include Tet-inducible CRISPR activators and repressor plasmids...

... bioRxiv. 2022 Dec 2. Use PiggyBac plasmids with tet-inducible expression of transcription factors for...

...24360272 Qi TET S. cerevisiae ACTTTTCTCTATCACTGATA 62313 scaffold S. pyogenes 25533786 Qi & Lim TET promoter...TATCAGTGATAGAGAAAAGT 46923 interfere S. pyogenes 23849981 Weissman Tet3G synthetic GTACGTTCTCTATCACTGATA 62327 activate/interfere...

... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

... tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance gene, reverse primer...forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI, forward primer pBRforEco... primer pBRrevBam GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI, reverse primer pCAG-...GAGTCACTTTAAAATTTGTATACAC (Invitrogen) ADH terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward...

...Gradinaru 117383-AAV1 TRE-DIO-eYFP An AAV genome with tet-inducible, Cre-dependent expression of the fluorescent...

... Wheeldon FgH1tUTG 70183 Mammalian/Lentiviral H1-Tet none S. pyogenes Herold lentiGuide-Crimson 70683 ...Zhang pRS416-dCas9-Mxi1 + TetR + pRPR1(TetO)-NotI-gRNA 73796 Yeast pRPR1(TetO) yes, interfere S. pyogenes...yes, nick S. pyogenes Duchek pAC5-dual-dCas9VP48-sgTetO 48237 Mammalian BbsI yes, activate S. pyogenes ...Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...62315 Yeast none S. pyogenes URA3 Lim, Qi pRPR1(1xTetO)_gRNA_handle_RPR1t 62966 Yeast HindIII none S. ...pyogenes EGFP Zou pRS416gT-GalL-Cas9 79903 Yeast RPR1(TetO) yes, cut S. pyogenes URA3 Davis eSpCas9(1.1) 71814...

...inserting OsTIR1 into the "safe harbor" AAVS1 locus (a tet-inducible OsTIR1 plasmid is also available). Second...unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many of which ...subunits of the paramagnetic ferritin protein were tethered to the C-terminus of TRPV4 (a pressure-sensitive...

... constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain...

...gene expression studies, which are evinced by the Tet system and visualization of single molecules via ...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and an inducible...however, remain bound to the mRNA since they are tethered AFTER the stop codon. Thus a non-translated mRNA...MS2 bacteriophage coat protein binding sites to tether many copies of the FP-coat protein fusions to their...

...that can be included in transfer plasmids include: Tet- or Cre-based regulation and fluorescent fusions ...cellular determinant is LEDGF/p75, a lentiviral tethering protein that recruits the pre-integration complex...

...Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 tetR F'[proAB lacIqZΔM15 Tn10(TetR Amy CmR)]  Note: Inactivating ... streptomycin Tn10   Confers resistance to tetracycline Additionally, Table 2 provides a quick reference...recombine.  F' proA+B+ lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15...supE44 λ-relA1 Δ(lac-proAB)/F' proAB+lacIqZΔM15 Tn10 (TetR) TOP10 Streptomycin MC1061 derivative. General...galE15 galK16 rpsL(StrR) endA1 λ- XL1 Blue Tetracycline Blue/white screening and routine cloning, nalidixic...lacIq Δ(lacZ)M15] hsdR17(rK- mK+)  XL10 Gold Tetracycline and Chloramphenicol High competency cloning ...

...PA-FPs come in 2 flavours- monomeric and tetrameric. Tetrameric PA-FPS are better for whole cell imaging...UV-Violet Cyan/ Green >2,000 Medium 490/ 511 Kaede Tetramer UV-Violet Green/ Red ~2,000 High 572/ 580 tdEos...UV-Violet Green/ Red N/A High 573/ 584 KikGr Tetramer UV-Violet Green/ Red >2,000 High 583/ 593 mKikGR...Monomer Blue Dark/ Red 20 Low 572/ 610 FP595 Tetramer Green Dark/ Red 70 - 1000 Medium 590/ 600 ...to preserve cellular structures (0.5-1% osmium tetroxide). These conditions destroy most PA-FPs, but, in...

...a look at some popular self-labeling tools: Tetracysteine: The first reported chemical labeling tag, from...Commercial ligands available Ease of use Tetracysteine (Cys4) 15 Biarsenical dyes (FlAsH, ReAsH...labeling specificity than short peptide tags like tetracysteine (Jing & Cornish, 2011). HaloTag and SNAP-tag...functional. In some cases, a small peptide tag like tetracysteine might be the only option that doesn’t disrupt...options for CLIP-tag and very few TMP-tag or tetracysteine labeling dyes.  If reaction speed is a priority...

...by L-arabinose and anhydrotetracycline (aTet), respectively. pMAZ-SK contains an aTet-inducible gRNA and...self-destruction" after induction with L-rhamnose and aTet. CRMAGE is much more efficient than traditional ...plasmids from this paper at Addgene. 3. Sakuma, Tetsushi, et al. “Multiplex genome engineering in human...

... RNA-guided methylcytosine editing by TET1 by co-delivering TET1 and protein factors for linking methylcytosine...., 2019. Fusing epigenetic modifiers such as TET1 with inactive Cas enzymes can alter gene expression...

...permeability Bactericidal 10-100 ug/mL Tetracycline tetracyclin Binds 30S ribosomal subunit; inhibits...in foil if a light-sensitive antibiotic like Tetracycline is used. Keep in mind that some E. coli strains...

...so, theoretically, saturated avidin could form tetramers of biotinylated protein. However, oligomerization... GE Life Sciences) or bio-layer interferometry (Octet, Pall ForteBio). Tips for using pMal-T-Avi-His/BirA...for plasmid version 2.0? Instruments such as an Octet may require less in vivo-biotinylated protein (total...

...fluorescent protein that was derived from the tetrameric yellow fluorescent protein (LanYFP) from the ...fluorescent protein mTPF1 is a monomeric version of the tetrameric cyan fluorescent protein from the coral Clavularia...approximately 484 variants, including some potential tetramer-breaking mutations. The library was then screened...

...NLS-MS2-RFP) the reporter mRNA, which contains the tethering sites for the fluorescent proteins and is driven...of the PP7 and MS2 coat protein binding sites to tether many copies of the FP-coat protein fusions to their...these papers did. Since the SunTag-based system tethers mRNAs to the plasma membrane, it’s not appropriate...

...development. They inserted an octet of MS2 hairpins into the gRNA tetraloop and went through subsequent ...They found that aptamer insertion in the gRNA tetraloop (a four base hairpin loop motif within the gRNA...

...either induce or repress Cre expression using TetON or TetOFF systems. So now hopefully creating a genetically... the cell can occur. Similar systems include tetracycline or doxycycline mediated activation of Cre to...

...FlAsH, ReAsH) and a short genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins... lipoic acid ligase, biotin ligase, phosphopantetheinyltransferase) – These enzymes catalyze the covalent...1c). Click chemistry (e.g., transcyclooctene–tetrazine)– Nonnatural amino acids can be incorporated into...

...photoswitchable tethered ligands (PTL), and photoswitchable, orthogonal, remotely-tethered ligands (PORTLs... secondary signaling pathways. Photoswitchable tethered ligands hold the ligand in close proximity to ...

... nonfluorescent until they bind a 6-residue tetracysteine tag (sequence: CCPGCC) that can be inserted ...interest, resulting in a C-terminal fusion of a tetracysteine tag. In addition, since these tags are so small...et al. "Hairpin structure of a biarsenical− tetracysteine motif determined by NMR spectroscopy." Journal...

...mL Kanamycin 50 µg/mL Spectinomycin 50 µg/mL Tetracycline 10 µg/mL Tips and FAQ What is the difference...

.... coli genome-wide CRISPR inhibition Covalent tethering of DNA template to Cas9 SECURE base editors Nme2Cas9...genome-wide CRISPR inhibition library Covalent tethering of DNA repair template to Cas9 Homology-directed...

...complexes with LacZ𝜔 and forms an active LacZ tetramer.  This tetramer cleaves chlorophenol red-b-D-galactopyranoside...

...DNA-binding domains, including the commonly used LexA and rTetR systems such that they activate gene expression ...advantages. T-DOGGs can be made drug-inducible using the rTetR system, but Cre-DOG lacks the toxicity that can ...

...speed of labeling. BioID requires 6-24 hours for tetracycline induced expression of the BirA* fusion protein...Split-BioID, Schopp et al allowed 24 hours for tetracycline induced expression and biotinylation of interacting...