Skip to main content
Addgene
Showing: 321 - 340 of 438 results

  2. Quickest Way to Deposit Plasmids: The Deposit Spreadsheet

    Type
    Blog Post
    ... expression, plant expression, mouse targeting, CRISPR, TALEN, synthetic biology, affinity reagent/antibody...Plasmids Searchable and Sortable gRNAs for Your Next CRISPR Experiment Suggest A Plasmid You'd Like to Find...

  3. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons.... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al....

  4. Plasmids 101: Degron Tags

    Type
    Blog Post
    ...several advantages over the alternative systems – CRISPR, siRNA, etc. Firstly, they are reversible mechanisms....1073/pnas.1216880109 Resources on Addgene.org CRISPR Plasmids – Protein Tagging CRISPaint Gene Tagging...

  6. Your Lentiviral Plasmid FAQs Answered

    Type
    Blog Post
    ...shRNA-mediated knockdown, Tet and Cre-regulated expression, CRISPR genome editing, and more. Not surprisingly, we ...Plasmids 101 Learn about genome-wide screening with CRISPR and Lentivirus Read about the ClonTracr Library...

  7. Bacterial Expression Systems

    Type
    Collection
    ...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...

  8. Addgene’s Blog Gets a New Look!

    Type
    Blog Post
    ...showcases the five main topics of the blog: Plasmids CRISPR Viral Vectors Fluorescent Proteins Science Careers...

  12. AAVs in Retinal Gene Therapy

    Type
    Blog Post
    ...trials for prevalent diseases - to name a few. CRISPR-based tools are also particularly well suited to.... Yu W and Wu Z., 2018. In vivo Applications of CRISPR-Based Genome Editing in the Retina. Front Cell ...

  13. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...Roberts B, et al. 2017. Systematic gene tagging using CRISPR/Cas9 in human stem cells to illuminate cell organization...

  14. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  15. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...optogenetics plasmids available from Addgene. The popular CRISPR/Cas9 genome editing system has been modified for...vivo genome editing. For more information on AAV-CRISPR, please see this blog post. Browse the article ...

  17. Molecular Biology Reference

    Type
    Guide
    ...editing is most commonly accomplished using CRISPR technology. CRISPR is composed of a DNA endonuclease and ...the genome. For more information on CRISPR check out Addgene’s CRISPR guide . Reporter Plasmids - Used for...
Showing: 321 - 340 of 438 results