...enzymes that can digest large amounts of DNA in as little as 10 minutes, but check with your enzyme’s manufacturer...

... and working at the bench, but the reality is a little different. Industry and academic jobs do exist,...

...strong antibody signal in the retinal sample, but little to no signal in the liver sample, which you do ...

...difficult to interpret your results. This can be a bottleneck for your experiment. Single vector systems containing...

...Parts II kit has a focus on infrastructure with shuttle vectors, several delivery systems which can be ...

...Atsushi Miyawaki. "Regulated fast nucleocytoplasmic shuttling observed by reversible protein highlighting." ...

...,000 nm and 1,200 nm, where there is relatively little tissue absorption, weak tissue scattering and small...

... The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. Find.... The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction...adenoviral genes necessary for virus production. The shuttle vector and the adenoviral plasmid have matching...standard BJ5183 with supercoiled pAdEasy™ and the shuttle vector, but this method results in a higher background... 7-10 days later. Vogelstein designed multiple shuttle vectors for different purposes. The pAdTrack series...necessary for replication have been deleted from the shuttle vector. Early gene E1 is provided by the transfected...Class of transfer vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain ...

...PRESTO-TANGO kit directly for drug screening or easily shuttle the optimized, expression validated GPCR sequences...

...CTACAAACTCTTCCTGTTAGTTAG 5' of attL1 in pENTR vector, forward primer pENTR-R ATGGCTCATAACACCCCTTG 3' of attL2 in pENTR vector...

...entry clone). The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now...cloned into a donor plasmid, it can be rapidly shuttled into any compatible Gateway® Destination vector...

...treatment, the Cas9(N)-FRB-NES fragment is actively shuttled out of the nucleus due to the nuclear export sequence...

...winners’. Negative Screen Negative screens are a little trickier than positive screens. In a negative screen...

...produce large amounts of a single antibody with little variation. Recombinant plasmids - Antibodies can...

...appropriately sized bottle for autoclaving. We make 400 mL of agar in 1 L bottles and 200 mL of agar in...to the same bottle and swirl to form a medium/agar colloid. Cover the opening of the bottle with its cap...Use lab tape to label the bottle with your initials, the date, and the bottle contents. This will clear... in 500 mL bottles. The extra empty volume is necessary to prevent your molten agar from boiling over ...but do not make an air-tight seal!) and tape the bottle with autoclave tape. The autoclave tape will darken...clear up any confusion later if your forget your bottle in the autoclave. Place the gel mix in the autoclave...pouring your plates - be sure to leave room for your bottle of molten gel mix, a tube rack containing the appropriate...

...a sterile 250 mL bottle. Aliquot 774 mL of DMEM + 2% HI-FBS into a sterile 1 L bottle. Add each plasmid...stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add 55 mL of heat-inactivated... mM MgCl 2 Add the following to the 2 L sterile bottle: 1836 mL deionized water + 100 mL of 1 M Tris HCl...Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting multiple times Adjust pH to...complete media, then transfer the cells into a sterile bottle. Rinse the CS2 with 100 mL of DMEM complete medium...plasmid DNA into the bottle containing the Opti-MEM. Mix well. Add 4 mL of PEI (1:2 μg DNA to μg PEI ratio...ratio). Shake the bottle up/down vigorously for 30 sec (it’s okay to make bubbles). Incubate at RT for 15...

...water bath weights can hold bottles in place. After putting your tubes or bottles in the water bath, place...baths that exist as scientists work with tubes and bottles of different sizes in the lab. Some water baths...water baths hold many liters of water to incubate bottles and containers. Water baths can also be placed ...be used in water baths with instructions on the bottle, for example, number of drops per liter. Place ...floating, you do not need to necessarily maneuver the bottles or tubes to identify them. Once the water bath ...temperature, remove the lid and place your tubes or bottles into the water bath. Many items may float in the...

...Loosely close the cap on the bottle (do NOT close all the way or the bottle may explode!) and then loosely...LB, weigh out the following into a 500 mL glass bottle: 4 g NaCl 4 g Tryptone 2 g Yeast Extract and dH...loosely cover the entire top of the bottle with aluminum foil. Autoclave and allow to cool to room temperature...temperature. Now screw on the top of the bottle and store the LB at room temperature. When ready to grow ...

...Chavez, A., Scheiman, J., Vora, S., Pruitt, B. W., Tuttle, M., Iyer, E. P. R., Lin, S., Kiani, S., Guzman...

...usually use one or the other, but there is very little difference between the two. Note: Make sure to ...increases the density of your DNA sample causing it settle to the bottom of the gel well, instead of diffusing...later use, use long-wavelength UV and expose for as little time as possible to minimize damage to the DNA....