... Cloning of basic parts (promoters, UTRs, genes, tags, etc.) into MoClo-compatible vectors. Level 1: Assembly...afterwards. To engineer these production pathways, MoClo has been used to assemble multigene constructs capable...

...Addgene.org Find Empty Backbones with Fluorescent Tags Find Plasmids for Subcellular Localization Browse... 2008) occasionally and certainly after a set-up has been changed (for instance after replacing a broken...

...such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual...large percentage of DSBs are still repaired by NHEJ. How do you determine that your desired edit has occurred...Cas9-gRNA ribonucleoprotein (RNP) complexes are advantageous due to the transient Cas9 expression. The table...: Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed...

...you to gauge how far the DNA has migrated; 2) it contains a high percentage of glycerol that increases ...continue towards a boil. Keep an eye on it the solution has a tendancy to boil over. Placing saran wrap over ...sit at room temperature for 20-30 mins, until it has completely solidified. Pro-Tip If you are in a hurry...with water to even out the staining after the gel has been run, just as you would if you had not added ...water and destain for 5 mins. Using any device that has UV light, visualize your DNA fragments. The fragments...adjust the agarose percentage of the gel to get better separation. A higher percentage agarose gel will ...electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave Reagents...

...DNA glycosylase inhibitor with a degradation tag (LVA tag) to achieve specific point mutations in E. coli...multiple gRNAs on one plasmid. Sound good? Addgene has many tools to help you multiplex - we’ll use mammalian...multiple promoter-gRNA cassettes, making them advantageous for small capacity vectors like AAV. In addition.... Yin, Linlin, et al. “Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs...

...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...

...similar to the original pCas/pTargetF but has many other advantages including shorter plasmid curing time....uracil DNA glycosylase inhibitor and degradation tag on the fusion protein to limit the activity of the...in bacteria, most CRISPR-based genome engineering has taken place in other organisms. In many bacteria,... targets cells in which homologous recombination has not occurred. This powerful negative selection system...plasmids Noting that the more common spCas9 system has generally low efficiencies or can be proteotoxic ...system can be delivered a number of ways but success has been observed with Phagemids (Selle et al., 2020,...microbiome Beyond the human gut, the Barrick lab has deposited plasmids that can be used to engineer the...

...against your target protein, consider fusing a protein tag to the target and using an epitope-based strategy...different species/isotypes and that each secondary has a different color fluorophore that you can image ...abundant in your samples (with a primary antibody that has the same species and isotype as the primary antibody...

...Alberta studying with the Szymanski lab (though she’s tagged along with the lab during its recent move to the...cost-effective method that our lab (the Szymanski lab, which has recently moved from the University of Alberta in ...Edmonton, Canada, to the University of Georgia, USA) has developed that allows for a phage genome to be probed...library construction for functional genomic and metagenomic screening." Applied and environmental microbiology...

...clones with pLKO.1 sequencing primer (5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’). TIP: You may need to adjust...vector is the backbone upon which The RNAi Consortium has built a library of shRNAs directed against 15,000...shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with... the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure... in contact with the walls of the tube before it has been diluted. Mix by swirling or gently flicking ... 5’ CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3’ Reverse oligo: 5’...AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3’ Back to Top C. Cloning Oligos into pLKO...

...the concentration of inducer or adding an affinity tag such as GST may help with solubility issues. We ... BL21 (DE3) pLysE* Chloramphenicol (pLysE) pLysE has higher T7 lysozyme expression than pLysS; expression...

...(2017). AAV-mediated Anterograde Transsynaptic Tagging: Mapping Input-Defined Functional Neural Pathways...auditory neuronal circuitry in vivo. A variant of RABV has been developed to only label a neuronal connection...example only dopaminergic neurons, neuronal tracing has the added benefit of only labelling the subset of... regions used. Evidence for retrograde transport has been found for AAV1, -2, -5, -7, -8 (Taymans et al...AAV5 (Aschauer et al., 2013). Anterograde transport has been observed for AAV1, -5, -8 (McFarland et al.,...variability compared to chemical tracers. rAAV2-retro also has lower affinity for heparin, which possibly explains...vectors cover some of these attributes and their use has allowed for the visualization of single connection...

...perfect empty backbone, made sure to add the right tags to your gene, and may have even put a fluorescent...OpenWetWare's E.coli genotype resource. Additionally, NEB has a great list of genetic markers for your reference...

...starting this procedure, be sure that the cell pool has been sufficiently selected with the appropriate antibiotic... antibiotic so that every cell in the culture has, in theory, been transduced. There are various schools...regularly for transgene expression. This protocol has been optimized for adherent cells but can be modified...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS 1X PBS...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...55 mL of heat-inactivated FBS and 5 mL of 100X glutaGRO. Store at 4 °C. Polyclonal stable cell pool: see...

...clogging during harvesting. The addition of sorbitol has been shown to increase viral titers by up to 1.8-...10 min and then recheck the pH to ensure that it has not drifted. Filter the solution through a 0.22 μm...such as sorbitol and sodium bicarbonate, sorbitol has been found to increase viral titers by up to 1.8-...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Opti-MEM, Thermo Fisher 31985...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ...add 55 mL of heat-inactivated FBS and 5 mL of glutaGRO 11 mL of 200 mM L-alanyl-L-glutamine. Store at 4 ....46 M sorbitol, 7.5 mL HI-FBS, and 7.5 mL 100X glutaGRO, 7.5 mL of 7.5% Sodium Bicarbonate, 7.5 mL 1 M...

...final volume of 1 L and recheck pH to ensure that it has not drifted. Filter the solution through a 0.22 µm...incubate for 1 h at room temperature. After the BCD TFX has warmed in the bead bath, transfer the tubes to the...-188 10% Pluronic F-18, Thermo Fisher 24040032 Glutagro, Corning 25-015-CI BalanCD HEK293 Media, Irvine...HEK293 Media 10 mL 10% Pluronic-F68 40 mL 200 mM Glutagro Do not add selective reagents Store at 4 °C until...BCD Feed 500 mL BalanCD HEK293 Feed 20 mL 200 mM Glutagro Store at 4 °C until use. We suggest preparing ...

...polyclonal cell population, meaning that the transgene has integrated in different locations in the various ...variety of dilutions and pick the population that has the most desirable level of expression. Over time...L-alanyl-L-glutamine (or alternative stable glutamine such as glutaGRO, Corning 25-015-CI) Heat-inactivated FBS Polybrene...L-alanyl-L-glutamine (or stable alternative, such as glutaGRO) To a 500 mL bottle of DMEM high glucose, add ... 55 mL of heat-inactivated FBS and 5mL of 100X glutaGRO. Store at 4 °C. Pro-Tip Different brands and FBS...

...of antibody and production strategy has advantages and disadvantages compared to each other. Polyclonal...Experimentally, antibodies conjugated to fluorescent tags or other markers can be injected into an animal,...produced for research purposes, some of which take advantage of natural immune system production and many more...as polyclonal. Polyclonal antibodies have the advantage of more robustly recognizing the target protein...proteins are also plasmid-derived. However, a disadvantage to ScFv is their lower affinity for their target...antigen as canonical antibodies. They also have the advantage of being significantly smaller, meaning they can...proteins you can investigate in each panel. An advantage of flow cytometry is the ability to use multiple...

... it is possible that the difference between them has affected the accuracy of the NanoDrop. It is a good...Background Information During several different stages of molecular cloning, it is important to get a ...

...time it has caught it has usually started to spread (metastasize) and turned into Stage 3 or Stage 4 cancer...and treatments such as these has brought a lot of promise to a field that has historically been full of ...size and may have spread while Stage 4 indicates that the cancer has spread from where it originated to...However, as the U.S. Environmental Protection Agency has noted, there is no safe level of asbestos exposure...abdominal cavity. This targeted chemotherapy approach has been shown to be successful in killing many (if not...patients: early detection and immunotherapy.  It has long been known that one of the best ways to improve...standard treatments and early detection, mesothelioma has proven itself to be susceptible to up and coming ...