We narrowed to 262 results for: GFP
-
TypeCollection... general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen Lab SapTrap CRISPR/Cas...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent...PITCh system plasmids for CRISPR-based knock-in of EGFP-2A-PuroR cassette to the C-terminus of endogenous...the donor vector. The PITCh donor plasmid with an EGFP-2A-PuroR cassette, flanked by microhomologous sequences...first deposited PITCh plasmids were tested by fusing EGFP-2A-PuroR cassette to a nucleolar protein, fibrillarin... gRNA pCRIS-PITChv2-FBL - PITCh donor vector for EGFP-2A-PuroR knock-in into human FBL locus Jorgensen... the donor plasmids containing homology arms and EGFP are available at Addgene. Do you have suggestions...
-
Luciferase Plasmid Collection
TypeCollection...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...phGluc Gaussia EF1α Expression of Gaussia luciferase; GFP is expressed if cells are infected with virus Christopher...Firefly TGB AAV expression of firefly luciferase and GFP James Wilson 106457 pCR3.1-Luc Firefly CMV Mammalian... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection... pX459 (Addgene plasmid ID 48139), which include GFP and puromycin as selectable markers, respectively...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...filter into a FACS tube. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that ... -
Bikard Lab - CRISPR Repression Collection
TypeCollection... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...for these two reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus ...sites. The levels of the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐... -
Sequencing Primers
TypeGuide...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP...pyogenes Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR... -
CRISPR References and Information
TypeCollection...vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (...Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles...plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human and... -
Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands
TypeBlog Post...labeling. Size is also a factor. Bulkier tags, such as GFP, may interfere with protein expression or function... -
Special Delivery: Fluorophore Targeting for FRET Studies
TypeBlog Post...protein, permeabilized cells Cy5NTAc 32 25-45 GFP (fluorescein is similar) Lumio Red Tc: CCPGCC 48... -
Recombinases AAV Preps
TypeCollection.../Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson... -
Plan Your Experiment
TypeCollection...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive... -
Adenovirus Guide
TypeGuide...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...throughout viral vector production. During experiments, GFP can be used to sort cells infected with rAdV vectors...recombinant adenoviral vector production that contain IRES-GFP. Pseudotyping The production of viral vectors (or...adenoviral vector production that do not contain GFP. Recombinant adenoviral vector (rAdV) Modified form... -
Antibody Production
TypeCollection... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently... -
Antibody Plasmid Collection
TypeCollection...find antibody plasmids for: Common antigens such as GFP or mCherry Monoclonals, Nanobodies, Sybodies, or ...peptide, from the popular SunTag system, fused to sfGFP for imaging. Learn more about antibodies and their... -
Worm Expression Resources
TypeCollection...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores... -
Antibody Validation for Flow Cytometry
TypeBlog Post...measurable through an epitope tag such as FLAG/His/GFP. Fluorescent protein tags, which correlate closely... -
Tetracycline Inducible Expression
TypeCollection...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...pTet-IRES-EGFP Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or... Off) None TRE, miniCMV Maria Lung 16542 pBI-MCS-EGFP Bidirectional promoter (Pbi) for Tet-responsive ...expression (On or Off) of both your gene of interest and EGFP. Pbi contains a TRE between two minimal CMV promoters...Retroviral Tet-On vector for CMV-driven rtTA with EGFP and Blasticidin selection rtTA-Advanced Mikhail ...TLCV2 Lentiviral vector for tet-inducible Cas9-2A-EGFP expression. Based on LentiCRISPR v2 . Adam Karpf... -
Delivery Methods for Generating iPSCs
TypeBlog Post...cassette comprised of OCT4, SOX2, LIN28, NANOG, and a GFP reporter. Minicircles are removed from cells by dilution... -
Fluorescent Protein Guide: FRET
TypeCollection...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-N1...to Amber via a 32 amino acid linker mGFP-10-sREACh-N3 Monomeric EGFP attached to super-REACh via a 10 amino... -
Plan Your Experiment
TypeGuide...typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells, or selection...transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich positive...