... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...

... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities...

.... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ...

...Spinocerebellar ataxia 22 Bernard Weinstein 21238 PKC gamma CAT PRKCG HA CMV Spinocerebellar ataxia 21 Bernard Weinstein... HA CMV ALS Catherine Tomasetto 104450 pEGFPC1-hVAP-B KD/MD VAPB GFP, HA CMV ALS Catherine Tomasetto 104465...

... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...

...Affinity Purification with Protein A or Protein G Recombinant Antibody Affinity Purification with Protein...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...Addgene's educational resources, including eBooks, science guides, videos, and protocols... Educational Resources...eBooks to videos and blog posts to protocols, our educational resources cover a wide range of topics in molecular...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...

...Origin of Replication? See our Plasmids 101: Origin of Replication blog).  The replication problem Plasmids...directly inhibit replication by binding to the origin of replication and blocking replication machinery (del... of microbial plasmids: classification and identification based on replication and transfer systems and...plasmid that contains the origin of replication and the replication control machinery (Need a refresher... that inhibits replication when copy number in the cell is high, but allows replication when copy number...either indirectly inhibit replication through inhibiting translation of replication machinery proteins, or...antisense RNAs inhibit plasmid replication.   Figure 1: The replication problem. Iterons are repeated...

...epigenome (the sum of epigenetic modifications across the genome) has been implicated in disease states, and targeting...DNA sequences. Non-editing CRISPR applications direct catalytically dead dCas9 fused to a variety of epigenetic... the catalytic domain of p300 acetyltransferase increases levels of H3K27ac histone modification at specified...Preps for Epigenetic Modification Why use epigenetic modifiers? Epigenetic modification is certainly not ...Nature Communications 8: . https://doi.org/10.1038/ncomms16026 Find plasmids from this publication at Addgene..., 2017 and updated Jun 24, 2020. Epigenetic modifications are an additional layer of control over gene...efficient. In general, epigenetic chromatin modifications are correlated with alterations in gene expression...

... can and do consume science communication.  Formal education is education that is provided through a structured...underlying all communications efforts.  Scicomm definitions (as used by Addgene)    Science communication, or science...time engaging with science communication efforts.  Scientific communication or scientific writing is peer...to note that it is the actual communication itself, not the communication method, that determines if something...scientific or science communication. A Tweet is still considered scientific communication if the language is... engage or disengage at will.  Informal education is education that is provided, typically ad hoc, for...Series, where we’ll be talking about science communication, best practices in the field, and even getting...

...that allows category-specific, narrow searches. We defined three top level categories — catalog, educational... in a given category, and serve as a shortcut to a search scoped to that category. Catalog ID suggestions...prefer to browse and discover items in our catalog or educational resources through our main dropdown menu... of Addgene’s customer’s needs. Categories We created a categorization of our information in order to ...depositors — each with subcategories such as plasmids and viral preps for catalog, blog posts and protocols...80,000+ reagents and 700+ educational resources — including blog posts, protocols, guides, and collections...sequencing data; as a result, the materials in our catalog are very well-characterized. During this time, ...

...the grant application process. When my PhD advisor first asked me to write a grant application due the ...in a previously funded grant application to see how funds were allocated. Step 3: Get feedback from your...the next round of applications. Step 5: Keep writing! Each written grant application builds upon the ... project grant application" by the NIH Still want more information on the application process? What types...advisor alone applies for these competitive grant applications; however, in some cases, your advisor may choose...writing, volunteered to take the lead on various applications throughout my graduate career, and helped receive...Proposal writing: Improves technical writing and communication skills, Elucidates the big picture and future...

...or DYKDDDK 1 Affinity and Purification Good for antibody-based purification; has inherent enterokinase...site GST Large Protein 26 Purification and Stability Good for purification with glutathione; protects...used for purification as elution requires low pH poly His HHHHHH  0.8 Affinity and Purification Very small...GKPIPNPLLGLDST   1.4 Affinity and Purification Good for antibody-based purification Combo and cleavage tags...multitude of uses including (but not limited to) purification, detection, solubilization, localization, or...fusion proteins to aid in the expression and purification of recombinant proteins. Tags for stability...be fused to recombinant proteins for one-step purification with glutathione, can also protect against proteolysis...

...single peak, indicating one amplicon and no primer dimers. (b) A shoulder peak indicating primer dimers...Method Standard Curve?  Amplification Efficacy Calculation Amplification Efficacy Assumptions ...understanding and technical proficiency with common applications - now let’s dive right in! You know qPCR is...is most commonly used to measure relative quantification of mRNA, which can be used as a proxy measure...as it solves, so understanding and using the application correctly is imperative. Picking your chemistry... at least 25 bp away from each primer, ideally located close to either the forward or the reverse primer...dimers. (c) A double peak indicating 2 amplicons. Image credits (respectively): Zuzanna K. Filutowska; Selma...

...variety of projects in the space of science education, communication, and policy. In this post, I hope to tell...science policy and science communication A career in science communication or policy requires broad interest...pursuing a career in science communication or policy, being able to communicate your work to a non-technical...series on careers in science communication Find all of our science communication posts Extracurricular activities... of New Initiatives for the Personal Genetics Education Project (pgEd). Advances in genetic technologies...inequalities and injustices. The Personal Genetics Education Project (pgEd), where I currently work, strives... as well as the personal, social and ethical implications of genetics. In these conversations, pgEd strives...

...switches. Stabilizing gRNA modifications  Sugar phosphate backbone modifications The recognition sequence...phosphorothioates with 2’-O-methyl modifications, proved more stability than just one modification alone (Hendel, et al...ordered as synthesis modifications when purchasing your gRNA. Pro tip: modifications are typically incorporated...stabilizing modifications listed above were developed before CRISPR-Cas9, for use in applications like siRNA...worrying about the status of your RNA. gRNAs modifications are even going beyond stability, adding color...cellular RNA molecules with post translational modifications. One of the most common of these is 2’-O-methylation...nucleolytic attack. Another stabilizing sugar modification, found at the same site, is 2’-fluoro (2’-F)...

...FAIRE-seq, and CHIP-seq), genome-wide identification and quantification of enhancer activity have remained...compartments (cytosol, Addgene catalog #71245; mitochondria, Addgene catalog #71247) Rosella provides an ...CpG methylation by fusing catalytically inactive Cas9 (dCas9) with the catalytic domain from DNA methyltransferase...  Superglue proteins with SpyTag/SpyCatcher and SnoopTag/SnoopCatcher The development of recombinant DNA...alternating the use of the SnoopTag/SnoopCatcher and SpyTag/SpyCatcher pairs. In order to improve the ease...MBPx-SpyCatcher construct. This construct is used to produce a maltose binding protein/SpyCatcher fusion...of larger fusions through SpyTag/SpyCatcher and SnoopTag/SnoopCatcher linkages. Once all of the desired...

...higher education nonprofit entities related to or affiliated with institutions of higher education nonprofit...for self-sponsorship of the I-140 application meaning that the category does not require a foreign national.... NIW requirements stress “educational background, expertise, publications, and plan for future activities...received 116,224 employment based green card applications and approved 91,023 during the first 3 quarters...for a role that is closely aligned with their education/experience, i.e. a research role, for a Ph.D. ...well-tailored to meet the needs of researchers. The categories are as follows: Cap Subject Industry H1B Academic...occupation" as requiring theoretical and practical application of a body of highly specialized knowledge in ...

...Technical Tips). Minigenome replication and transcription In order to replicate the minigenome, the viral...transcription and replication strategies of Marburg virus and Ebola virus by using artificial replication systems...allowing researchers to study aspects of the EBOV replication cycle under BSL-2 conditions (4). What is a ...that are crucial cis-acting signals for genome replication and viral gene transcription (6). The EBOV genome...5’ ends of the genome which are required for replication and transcription (Figure 1). All viral genes...cis-acting signals necessary to direct minigenome replication and reporter gene transcription by the EBOV polymerase... in 2, 5). The minigenome is capable of being replicated and transcribed in the cell when the appropriate...