Skip to main content
Addgene
Showing: 1 - 20 of 42 results
  1. Five Popular Model Organisms, Part 2

    Type
    Blog Post
    ...and Tol2 transposase induced transgenesis.  Xenopus Xenopus, or frogs, are one of the most popular model... developmental and biomedical research.  Xenopus, aka African frog. Image from Holger Krisp. ...major resource for frog research is The National Xenopus Resource, a breeding facility for X. laevis and...embryogenesis. Addgene has over 600 plasmids that contain Xenopus genes and a tool-kit from the Hamdoun Lab to create... fusions in a multitude of organisms including Xenopus. Overall, the ability for scientists to study human...10.7554/elife.05826 Blum, M., & Ott, T. (2018). Xenopus: An Undervalued Model Organism to Study and Model...
  2. What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program

    Type
    Blog Post
    ...in water and on land. Current tools are all for Xenopus (aquatic frogs), but there are few genetic tools... Henry Lab (@EvoEmbryo) September 24, 2018   Xenopus tropicalis (Gary Gorbsky) This is not a new experimental...experimental system, but the Gorbsky Lab is using Xenopus frog cell lines to develop robust methods for frog...
  3. Hot Plasmids: Summer 2024

    Type
    Blog Post
    ... 5 Å resolution) of the linker histone H1.8 in Xenopus nucleosomes and in complex with its chaperone NPM2...
  4. Sequencing Primers

    Type
    Guide
    ...GACTCCATTCGGGTGTTC Xenopus beta-globin 3'UTR, reverse primer XEF1a TTTCGCCCTAACTTCGTGAT Xenopus EF1 alpha enhancer...
  5. CRISPR Plasmids - Xenopus

    Type
    Collection
    ... CRISPR Xenopus CRISPR Plasmids: Xenopus Browse CRISPR Plasmids By ...have been designed for use in Xenopus. CRISPR...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols... CRISPR plasmids have been designed for use in Xenopus. Cut Fully functional Cas9 enzymes designed to ...
  6. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...Drosophila, plants, C. elegans, yeast, zebrafish, and Xenopus. Mammalian Plasmid Gene/Insert Promoter Selectable...Insert Promoter Selectable Marker PI Publication Xenopus Plasmid Gene/Insert Promoter Selectable Marker ...
  7. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...8CCerulean - Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NCerulean - Zebrafish/Xenopus/C.elegans/Sea urchin...pCS2+8CeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NeGFP - Zebrafish/Xenopus/C.elegans/Sea urchin...8CmCitrine - Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmCitrine - Zebrafish/Xenopus/C.elegans/Sea urchin...8CmOrange - Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmOrange - Zebrafish/Xenopus/C.elegans/Sea urchin...8CmCherry - Zebrafish/Xenopus/C.elegans/Sea urchin pCS2+8NmCherry - Zebrafish/Xenopus/C.elegans/Sea urchin... with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C. elegans Hamdoun Lab Plasmids - Set includes...
  8. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ... expression vector from Gileadi lab Xenopus SP6 for transcription and injection pCS2P+ - Transcription...a variety of systems, including Xenopus HA Epitope Tag pKH3 - N or C-terminal ...a variety of systems, including Xenopus pAG423GPD-ccdB-HA - C-terminal 3xHA...
  9. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...
  10. Cre-lox system

    Type
    Collection
    ...tdTomato coexpression Xenopus hsp70 Xenopus Ryffel 31132 pCSCre Cre CMV Xenopus Ryffel 31309 pCARCre Cre...30524 pCSHSP:Cre heat shock inducible Cre Xenopus hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI... Cre cardiac actin Xenopus Ryffel 32144 pJFRC170-3XUAS-IVS-Cre::PEST Cre expressed at low levels to reduce...Tamoxifen inducible. Expressed in chondrocytes Xenopus Col2a1 Vertebrate Tanaka 111153 pGEMT-Pax7bait-...
  11. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ...Kearns et al., Development. 2014..) CRISPRs for Xenopus! From the lab of Yonglong Chen, pCS2-3xFLAG-NLS-SpCas9...used by Chen and colleagues for genome editing inXenopus tropicalis. (Guo et al., Development. 2014..) ...
  12. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...
  13. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols...
Showing: 1 - 20 of 42 results