We narrowed to 222 results for: ung
-
TypeBlog Post...informative events are one of the main ways budding young scholars across Europe get introduced to the cultures...organisation is to encourage iGEM alumni to mentor younger students in society and to support iGEM alumni-...and networking meetups. The society hopes to help young scientists interested in this field excel and develop...to see these biological societies engaging with young scholars. We believe it’s very important to develop...mentioned above provide strong foundations upon which young scientists can build powerful networks and we encourage...
-
CRISPR 101: Cytosine Transversion Editors
TypeBlog Post... uracil DNA N-glycosylase (UNG) from E. coli. The resulting construct, eUNG-BE4max(R33A)ΔUGI, was given...Editor, or GBE, for its reliance on the glycosylase UNG to crease abasic sites (Zhao et al., 2021). Their...processes. Created with BioRender.com. Beyond UNG: Optimizing C → G editors Now that several labs had...mechanism: cytidine deaminase converts C to U, and UNG excises the new U to create an abasic site. But how... repair proteins fused to CGBEs Instead of using UNG, the Wei Leong Chew Lab developed two fusions of ...Yuan et al., 2021). In addition, they showed that UNG from both E. coli and C. elegans could be effective...team also demonstrated that different deaminase and UNG enzymes had different sequence preferences, which... -
Synthetic Biology - Fungal
TypeCollection... Plasmid Collections Synthetic Biology Fungal Synthetic Biology: Fungal SynBio Resources...collection of synthetic biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort... for use in fungus. Plasmid... -
CRISPR 101: Any Base Transversion Editors
TypeBlog Post...either fused or endogenous Uracil DNA N-glycosylase (UNG) enzymes. Various other proteins included in different...guanosine instead, perhaps analogous engineering of UNG, which excises uracil, could allow it to recognize... et al., 2024; Yi et al., 2024). In each case, a UNG enzyme was modified to recognize T and/or C substrates...Also called an apurinic / apyrimidinic (AP) site. UNG / UDG Uracil DNA N-Glycosylase Removes uracil from... -
CRISPR 101: Cytosine and Adenine Base Editors
TypeBlog Post...uracil N-glycosylase (UNG) during base excision repair. Adding a second copy of the UNG inhibitor, UGI, increases...and cytosine editing components together. Keith Joung’s lab created a dual-deaminase editor called SPACE... M. S., Rinaldi, C., Slaymaker, I. M., Yen, J., Young, L. E., & Ciaramella, G. (2020). Directed evolution...R., Langner, L. M., Hsu, J. Y., Aryee, M. J., & Joung, J. K. (2020). A dual-deaminase CRISPR base editor...A., Sawyer, C., Schwaegerle, N. D., Peraro, L., Young, L., Lee, S.-J., Ciaramella, G., & Gaudelli, N. ... -
Pipetting Protocol
TypeProtocol...pipette ready, push down the plunger. There will be multiple “stops” on the plunger, where you feel resistance... front view photo of a P1000 pipette shows the plunger at the top, which is used to draw and expel liquid...shows the volume adjustment ring right below the plunger. This ring changes the pipette volume. Below that...behind the numerical display or the top of the plunger of the pipette. Select the pipette tip that is ...ve reached step 8. Continuing to hold down the plunger, gently lower the pipette tip into the liquid. ...end of the tip is submerged, slowly release the plunger, allowing it to go back to its resting position...the pipette tip). Then, slowly press down on the plunger all the way to the second stop to release the liquid... -
Water Bath Protocol
TypeProtocol...Disinfectant may be added to prevent growth of bacteria or fungi. There are disinfectants designed to be used in ... -
Gibson Assembly Protocol
TypeProtocol...to New England Biolabs by TelesisBio. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO.... -
Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System
TypeBlog Post...explains. Elizabeth Unger: Developing a serotonin sensor The goal of Elizabeth Unger’s postdoctoral work...Commemorative Travel Awards: Melissa Chiasson, Elizabeth Unger, and Michal Bernach. Melissa Chiasson: Quantifying... fluorescent sensor for serotonin. According to Unger, “serotonin is a well-known but poorly studied neuromodulator...incredibly important for nearly every aspect of life.” Unger began with the a bacterial periplasmic binding protein...no known bacterial proteins that bind serotonin. Unger redesigned the binding pocket of the periplasmic...for serotonin by over four orders of magnitude. Unger validated the serotonin sensor with proof-of-principle...can also kinetically outperform current methods. Unger plans to use the sensor to answer the question of... -
Stem Cell Models for Disease & Open Science: Interview with Darrell Kotton
TypeBlog Post... on the lungs, and, among other projects, using stem cells to develop in vitro models for lung disease...goal - to develop therapies to treat disease in the lung. Chapter 2: Balancing research with medical practice...used to better understand the biology of certain lung diseases. Chapter 6: Near-term possibilities for...for using engineered cells in therapy. The lungs are difficult, but other tissues like the retina have ...therapies underway. Chapter 7: Generating entire lungs using a decellurized scaffold as a base. Darrell... using stem cells from patients to study various lung diseases. Chapter 10: How Darrel defines Open Science... -
Viral Vectors 101: Systemic Capsids
TypeBlog Post...mechanism unknown) Chen et al., 2023 AAV9.452sub.LUNG1 Lung: ATII cells Mice N/A Goertsen et...type II cell transduction in the rodent lung AAV9.452sub.LUNG1 is an engineered capsid derived from AAV9...has tropism for lung cells, and has increased overall transduction throughout the lungs. Like other engineered...AAV9 that effectively transduces mouse lungs, targeting alveolar epithelial type II cells (Goertsen, Goeden... does express in the brain. Both AAV9 and AAV9.452sub.LUNG1 have significantly higher off-target expression...including PAL1D, are detargeted from the liver, kidney, lung, and thymus, and transduce the heart and spleen ...Flytzanis, N. C., & Gradinaru, V. (2022). Targeting the lung epithelium after intravenous delivery by directed... -
Validated gRNA Sequences
TypeCollection...pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243 cut S. pyogenes 23360964 Joung GABPA H. sapiens...pyogenes 23360964 Joung RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes 23792628 Joung rol-6(su1006...pyogenes 23360964 Joung tph1a D. rerio GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung TRE3G H. sapiens...pyogenes 23792628 Joung VEGF H. sapiens GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung VEGF H. sapiens...GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes 23360964 Joung ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...GGAAACTACAGCCCAGCGTC 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut... -
The PAM Requirement and Expanding CRISPR Beyond SpCas9
TypeBlog Post...Cas9s with novel PAM recognition In 2015, Keith Joung’s lab performed a series of positive selection screens...Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev...Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F (2017) RNA editing with CRISPR-Cas13....Park SW, Kim D, Kim K, Cho H-Y, Song DW, Lee KJ, Jung MH, Kim S, Kim JH, Kim JH, Kim J-S (2017) In vivo...Gonzales APW, Li Z, Peterson RT, Yeh J-RJ, Aryee MJ, Joung JK (2015) Engineered CRISPR-Cas9 nucleases with ...Nguyen NT, Welch MM, Lopez JM, McCaw ZR, Aryee MJ, Joung JK (2016) Genome-wide specificities of CRISPR-Cas...Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F (... -
Viral Vectors 101: AAV Serotypes and Tissue Tropism
TypeBlog Post..., 20234Kaludov et al., 2001; Walters et al., 20015Dhungel et al., 2025 Depending on how you count, there...has broad tissue tropism, including liver, muscle, lung, CNS, kidney, retinal, and pancreatic cells (Ahuja... is particularly well-suited for transduction of lung cells via airway administration (Halbert et al.,...identifying a binding receptor published this year (Dhungel et al., 2025)! It can transduce neurons for retrograde...AAV1, AAV8, AAV9 Kidney AAV8 Liver AAV8, AAV9 Lung AAV6 Pancreas AAV2, AAV8 Photoreceptor cells...1359–1368. https://doi.org/10.1089/hum.2008.123 Dhungel, B. P., Xu, H., Nagarajah, R., Vitale, J., Wong...Transduction of Airway Epithelial Cells in Mouse Lungs Compared to That of AAV2 Vectors. Journal of Virology... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection..., cut S. pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter...Mammalian U6 none As Cpf1 Joung BPK3082 78742 Mammalian U6 none Lb Cpf1 Joung pLentiCRISPR-E 78852 Mammalian... meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus Joung BPK2101 65770 ...Goldstein DR274 42250 C. elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes... MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach...pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen) 48140 Mammalian BbsI yes, nick S...Wente DR274 42250 Zebrafish BsaI none S. pyogenes Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...to their own devices. Chytrid fungi (Lillian Fritz-Laylin) Chytrid fungi are useful for the study of basic... basic evolution of fungi and eukaryotes and includes the fungus that is killing frogs all over the world...diverse plants, animals, microbes, viruses, and fungi for which these methods are presently unavailable...world. These are less well known fungi (they are not yeast or mushrooms) but there are over 1,000 species... -
Finding nucleic acids with SHERLOCK and DETECTR
TypeBlog Post...References Abudayyeh OO, Gootenberg JS, Konermann S, Joung J, Slaymaker IM, Cox DBT, Shmakov S, Makarova KS... Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA,..., Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F (2017) Nucleic...science.aam9321 Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F (2018) Multiplexed and portable...Wolf YI, Gootenberg JS, Semenova E, Minakhin L, Joung J, Konermann S, Severinov K, Zhang F, Koonin EV ...Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F (... -
CRISPR Guide
TypeCollection...Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, D., Kim, S., & Kim,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti, M. D...., Liu, M., Hibshman, G. N., Dangerfield, T. L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D....Sousa, A. A., Harrington, L. B., Sternberg, S. H., Joung, J. K., Yildiz, A., & Doudna, J. A. (2017). Enhanced..., J. A., Khayter, C., Maeder, M. L., Reyon, D., Joung, J. K., & Sander, J. D. (2013). High-frequency off-target... Y., Sander, J. D., Reyon, D., Cascio, V. M., & Joung, J. K. (2014). Improving CRISPR-Cas nuclease specificity...., Peterson, R. T., Yeh, J. J., Aryee, M. J., & Joung, J. K. (2015). Engineered CRISPR-Cas9 nucleases ... -
Neurodegeneration Plasmid Collection
TypeCollection...Axel Brunger 12339 pBD-0071 VCP His T7 ALS Axel Brunger 12344 pBD-0010 VCP His T7 ALS Axel Brunger 12345...Axel Brunger 12346 pBD-0013 VCP His T7 ALS Axel Brunger 12347 pBD-0006 VCP His T7 ALS Axel Brunger 12348...Axel Brunger 12349 pBD-0070 VCP His T7 ALS Axel Brunger 12350 pBD-0069 VCP His T7 ALS Axel Brunger 12351...Axel Brunger 12352 pBD-0007 VCP His T7 ALS Axel Brunger 12353 pBD-0018 VCP His T7 ALS Axel Brunger 12354...Axel Brunger 12355 pBD-0022 VCP His T7 ALS Axel Brunger 12356 pBD-0024 VCP His T7 ALS Axel Brunger 12357...Axel Brunger 12358 pBD-0035 VCP His T7 ALS Axel Brunger 12359 pBD-0039 VCP His T7 ALS Axel Brunger 12360...Axel Brunger 12361 pBD-0072 VCP His T7 ALS Axel Brunger 12362 pBD-0050 VCP His T7 ALS Axel Brunger 12363... -
Multiplexed Overexpression of Regulatory Factors (MORF) collection
TypeBlog Post...possible TF-induced cellular states was generated (Joung et al., 2023). Fig. 1: Barcoded TF library...performed to map TFs to cell fates. (Adapted from Joung et al.) This atlas linked TF expression to... nominated reference cell types. (Adapted from Joung et al.) Putting MORF to work Screens and ...addgene.org! References and Resources References Joung J. et al., A transcription factor atlas of directed...186 (1) 209-229. doi: 10.1016/j.cell.2022.11.026 Joung J. et al., Genome-scale CRISPR Cas-9 knockout and...