Skip to main content
Addgene

We narrowed to 40 results for: tef

Showing: 1 - 20 of 40 results
  1. Validated gRNA Sequences

    Type
    Collection
    ... Hanna TEF S. cerevisiae TTGATATTTAAGTTAATAAA 62320 scaffold S. pyogenes 25533786 Qi & Lim TEF1 S. cerevisiae...
  2. Cre-lox system

    Type
    Collection
    ...60930 pPL5071_TEF1*-Cre_URA3 Cre expressed at low levels mutant TEF2 Yeast Piper 60931 pPL5608_TEF1*-Cre_TRP1... mutant TEF1 Yeast Piper 60932 pPL5606_TEF1*-Cre_ADE2 Cre expressed at low levels mutant TEF1 Yeast Piper...Piper 60933 pPL5628_TEF1*-Cre_MET15 Cre expressed at low levels mutant TEF3 Yeast Piper 61391 pCS2-Cre.zf1...
  3. Embracing Serendipity: A Crucial Element in the PhD Journey

    Type
    Blog Post
    ...my career and life where I excel (and thus feel grateful) and identify areas in need of improvement. These... the world solely through logic and adopting a grateful, wonder-filled perspective that recognizes marvel...
  4. PiggyBac-ing Through the Genome Editing Field

    Type
    Blog Post
    ...PMCID: PMC4663986. 2.  A. M. Singh, V. V Adjan Steffey, T. Yeshi, and D. W. Allison, “Gene Editing in ...PMC4686154. 3. A. M. Singh, D. W. Perry, V. V. A. Steffey, K. Miller, and D. W. Allison, “Decoding the Epigenetic...
  5. Botman-Teusink Yeast FP Collection

    Type
    Collection
    ...p415 plasmid (Loqué et al., 2007) containing the TEF1 promoter and the LEU2 marker, or the pCEV-G2-Km ...Km plasmid (Vickers et al., 2013) containing the TEF1 or PGK1 promoters and the KanMX marker. ID Plasmid...
  6. Addgene's 20th Anniversary Party

    Type
    Blog Post
    ...individuals that makes Addgene — well, Addgene. We're so grateful for each and every one of you!  Throughout the...
Showing: 1 - 20 of 40 results