... of restriction sites. The lambda red system is derived from the lambda red bacteriophage and its use ...recombination. Key components of the Lambda Red recombineering system The lambda red recombineering system has three...Expression of Lambda Red recombination genes There are four ways to express the lambda red recombineering...stably express lambda red recombineering genes due to integration of a defective lambda red phage. One such...A final option for expressing the Red system is to use a lambda red phage, λTetR, that carries the tetracycline...long with the desired alteration(s) located in the center of the sequence. Since lambda red has a higher... be made at restriction enzyme cut sites. The lambda red system is an alternative method that can be used...

...exogenous enzymes: Lambda red and CRISPR Developed over the past 20 years, Lambda Red recombineering, which...), and those which increase the efficiency of Lambda red (Pyne et al., 2015; Reisch and Prather, 2015)...Khetrapal et al., 2015). They created vectors for Lambda Red that contained one of eight bacterial toxin genes... et al. "Coupling the CRISPR/Cas9 system with lambda red recombineering enables simplified chromosomal...posts Find our CRISPR blog posts Learn more about Lambda Red recombineering Resources on Addgene.org Find... which uses enzymes domesticated from the Lambda bacteriophage, is arguably the most widely and productively...replication only in hosts carrying the bacteriophage lambda pir protein. This allows conjugation between a ...

...excision recombination reactions that take place when lambda phage infects bacteria. In vivo, these recombination...regeneration of attP and attB sites.   Figure 1: Lambda phage integration and excision reactions. Recombination...3. Ptashne, M. (1992). A Genetic Switch: Phage (Lambda) and Higher Organisms (Cambridge, MA: Cell Press...sites so that scientists can easily clone in their desired DNA sequences. Gateway technology relies on the...coli strains, most colonies should contain the desired, recombined construct. Read our recent Plasmids...where we might use Gateway cloning to generate our desired constructs: lentiviral expression of the human ...There are a few different ways to generate our desired entry clone - human KRAS flanked by attL sites....

...libraries means that the diversity introduced by lambda red recombineering and Multiplex Automated Genome...bacterial genome engineering   Learn more about lambda red recombineering of bacteria Use site directed ... per generation, and (2) the addition of the thioredoxin-binding domain (TBD) from bacteriophage T7 DNA...of spectinomycin, rpsE. These results not only uncovered novel resistance genotypes, but also provide a...

...immunoglobulin lambda joining group IGLJ IGLJ1 immunoglobulin lambda joining 1 J1 IGLJ2 immunoglobulin lambda joining...A14 IGL@ immunoglobulin lambda locus IGL, MGC88804 IGLC1 immunoglobulin lambda constant 1 (Mcg marker)...immunoglobulin lambda constant 2 (Kern-Oz- marker) IGLC, MGC20392, MGC45681 IGLC3 immunoglobulin lambda constant...immunoglobulin lambda constant 6 (Kern+Oz- marker, gene/pseudogene) IGLC IGLC7 immunoglobulin lambda constant... 2 J2 IGLJ3 immunoglobulin lambda joining 3 J3 IGLJ4 immunoglobulin lambda joining 4 (non-functional) ...IGLJ5 immunoglobulin lambda joining 5 (non-functional) - IGLJ6 immunoglobulin lambda joining 6 - IGLJ7 immunoglobulin... immunoglobulin lambda joining 7 J7 IGLV@ immunoglobulin lambda variable group IGLV IGLV1-36 immunoglobulin...

...PNK polynucleotide kinase 165521 pOpen-lambda red operon lambda red operon 165530 pOpen-T4-BGT T4-BGT beta-glucosyltransferase...consists of more than 75 genes for enzymes that are considered "workhorses" of molecular biology, including ...transforming into E. coli bacteria. This can help reduce lab costs and overcome supply chain issues, particularly...

...additional efficiency measurements using similarly sized Lambda amplicon inserts to control for any suppression...transformants by colony PCR confirmed the insertion of the Lambda insert at the same high frequencies as the antibiotic...two-step assemblies. We have reduced these limitations through the use of engineered Type IIS restriction enzymes... push the test system, we redesigned for 12 and 24 fragments.  This redesign was guided by both advances...allowing multiple fragments to be assembled in an ordered, pre-determined manner. If the original insert ...restriction enzyme and ligase, thereby enhancing the ordered assembly of the target construct. Development of...assembly Single insert cloning efficiencies were measured based on the acquisition of antibiotic selectable...

... our Plasmids 101 blog posts Learn more about Lambda Red recombineering Learn more about counter-selection... amino acid, the bacteria will only grow if it acquired the plasmid containing the gene necessary to synthesize...

...community. Prior to this, bacteriophage, especially lambda, was the tool of choice for molecular biologists...that could be transferred between cells. At the time, these extranuclear agents of heredity were thought...extrachromsomal hereditary determinant”. His proposal, however, was basically ignored. A separate term...wild idea of using the newly discovered EcoRI enzyme (and its predictable cut site) to develop the first..., especially since the Fertility, or F-factor discovered by Ester Lederberg in 1952 was noted to integrate...-factors. Like F-factors, R-factors could be transferred between bacteria via cell-to-cell contact; however...ever since! From napkins to notebooks Although discovered in the early 1950s, it took until the 1970s for...

...technology (Ronda et al., 2016). pMA7CR_2.0 expresses lambda Red and Cas9, which are separately inducible by L-arabinose...contains Cas9 and the phage recombination gene lambda Red. pTargetF contains the specific gRNA(s), and ...Will Arnold. Although CRISPR systems were first discovered in bacteria, most CRISPR-based genome engineering...cells in which homologous recombination has not occurred. This powerful negative selection system ensures...is possible with efficiency >70%. CRMAGE is an incredibly fast protocol, with only 5 hours incubation time... pTargetF and pCas plasmids can be subsequently cured from the bacteria. Although developed in E. coli...variant fused to bacterial enhancer binding protein required for the activation of sigma-54 type promoters....

...This method, developed by Invitrogen and based on lambda phage integration sequences, relies on site-specific...your protocols, designed your experiments, and prepared your reagents. You’re going to engineer the best...to look at the prices of the additional enzymes required. FastCloning may be the least expensive of all...restriction enzymes. In Golden Gate cloning, the desired end construct does not contain the type IIS recognition...to keep the type IIS enzymes in the reaction to redigest vector reseals and other incorrect products. This...This feature biases the reaction in favor of the desired assembly to make the process close to 100% efficient...assembly allows one to simultaneously complete an ordered set of scarless ligations following digestion with...

...Promoter from bacteriophage lambda Can be temperature regulatable  Often paired with the temperature sensitive...

...replicon for self-curing, an arabinose inducible lambda-red gene, and an IPTG-inducible sgRNA sequence targeting... 24 nt oligos are required and the BsaI linearized pEcgRNA backbone can be prepared in large amounts and...generation of engineered cells for green chemistry and biomedical applications.   Yiwen Zhang entered the Sheng... now take place. After editing, pTargetF can be cured from the cell by inducing expression of the sgRNA...cut by Cas9. This would result in the lack of recovered transformants. Our speculation motivated us to...DNA for editing to take place. Then plasmids are cured from the cell. Steps 1-1 and 1-2 can be done simultaneously...sgRNA targeting the genomic site of interest. We compared the pCas/pTargetF system with the updated pEcCas...

...surgery relies on identification of the bregma and lambda sutures and subsequent determination of the proper... us to show causality in neural circuits with incredible temporal and spatial precision (I’m not going...straightforward to learn and relatively cheap (compared to many other technologies and techniques in the...appropriate test.  Of course, proper controls are required and include, for example, confirmation of opsin...optogenetics experiment and what are the tools required for each one? Behavioral Optogenetics can be broken... the optogenetic constructs Expression of your desired optogenetic construct in the brain region and cell...Stanford University , one of the key scientists who pioneered the development of optogenetics, has genetically...

... , Cyan , Green , Yellow , Orange , Red , Far-Red , Near-Infrared , Large Stokes Shift , Photoactivatable...protein of interest. pJT106b3 31393 Red light inducible inverter Red light (650 nm) Christopher Voigt When...and pPLPCB(S), makes lacZ expression inducible by red light. pCph8 50552 pLtetO-1 Anhydrotetracycline Jeffrey...Tabor Anhydrotetracycline inducible expression of red light responsive sensor protein, pCph8 , to be used...Bacterial Two-Hybrid System Various Plasmids placO with lambda-C1 operator Beta-galactosidase Ann Hochschild Bacterial...many questions about bacteria themselves, can be answered using model bacterial systems and plasmids avaliable...thereby limiting the use of cellular resources required for the production of large amounts of protein...

...Engineering) technology. pMA7CR_2.0 expresses lambda Red and Cas9, which are separately inducible by L-arabinose...cell that gets the plasmid contains all of the desired gRNAs. This increases the chance that all the edits...nickases to generate a knockout or edit. This can help reduce off-target activity. Deleting a large region of... to link together multiple fragments, allowing ordered assembly of multiple components into a destination...overhang sequences can link together to allow for ordered assembly into a destination vector that expresses...below.   Figure 2: gRNA target sequences (colored rectangles) are cloned into various plasmids using... cut sites “link” fragments together and drive ordered assembly into a Cas9-containing destination vector...

...terminator, reverse primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer...primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of DsRed1, forward primer DsRed1-N GTACTGGAACTGGGGGGACAG...GTACTGGAACTGGGGGGACAG (BD Biosciences) 5' end of DsRed1, reverse primer EBV Reverse GTGGTTTGTCCAAACTCATC...

... location: it is both red and green through much of the cell, but turns more red in lower (e.g. vacuolar...optimizations are required for each individual target species. Indeed, in order to use MAGE, the λ Red recombinase...set of plasmids (dubbed pORTMAGE) expresses the λ Red recombinase enzymes, as well as a dominant-negative...Src and Abl (Seeliger et. al. 2005). In this kit, Lambda phosphatase (Plasmid 79748) enhances bacterial ...brightly-coloured Australian parrot, the dual colour-emission biosensor Rosella consists of DsRed connected...advantageous when individual protein expression is preferred or required, or when it is difficult for a cell to synthesize...targeted for degredation via ubiquitination. The key feature of auxin-induced degredation is the speed...

...supE44 ara14 galK2 lacY1 proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15...genetic elements using specifically engineered plasmids, commonly referred to as vectors, which have become...division is reduced (i.e., it takes more time to copy this extra DNA). Because of this reduced fitness, ...In 1975, Frederick Sanger developed the process termed Sanger sequencing, sometimes referred to as chain-termination...would be necessary to isolate a sequence of a few hundred or few thousand basepairs from the entire human...the original cell. The plasmid DNA is similarly referred to as cloned DNA, and this process of generating...organisms, including plants, worms, mice, and even cultured human cells. Although plasmids were originally...

...cross-talk. These pairs are closely related to the lambda phage integrase system which is the basis for Gateway...will appear yellow, but a translated mRNA will be red. This system achieves great specificity and resolution... and that fluoresce in the green (500-550nm) and red (570-620nm) portions of the spectrum. PhD student...transitions from emitting orange (λ= 565nm) to far-red (λ= 662nm) fluorescence after exposure to blue-light...Biology (2014) represent the newest versions of both a red- and a green-light switchable bacterial TCS system...aaRS pairs are delivered via a pseudotyped baculovirus system, which is advantageous compared to other viral... Good tools for measuring intracellular pH are required in order to determine the relationships between...