... Protocols Gibson Cloning Gibson Assembly Cloning You may also...to include in the Gibson reaction are different than with normal PCR primers (Gibson et al. , 2010). Number...new window) . Gibson Assembly® is licensed to New England Biolabs by TelesisBio. Gibson DG, Young L, Chuang...nmeth.1318 (Link opens in a new window) Gibson DG, Smith HO, Hutchison CA, Venter JC, Merryman C. (2010). ...OpenWetWare: Gibson Assembly (Link opens in a new window) OpenWetWare: Janet Matsen’s guide to Gibson Assembly...Get started with Gibson Assembly Cloning! Protocols...Molecular Biology Protocols Summary In 2009 Dr. Daniel Gibson and colleagues at the J. Craig Venter Institute...

...the proper personal protective equipment (PPE) for BSL-1 and BSL-2 labs.... Protocols Personal Protective...Protective Equipment (PPE) for BSL-1 and BSL-2 Labs Personal Protective Equipment (PPE) for BSL-1 and BSL-2 Labs...

...Proteins Michael Davidson Fluorescent Protein Collection Michael Davidson Fluorescent Protein Collection...Davidson lab fluorescent protein fusion constructs and backbones. Plasmid...Subcellular localization Optogenetics The lab of Michael Davidson from Florida State University has contributed ...localization data found below. In addition, the Davidson lab has contributed the corresponding empty backbone...with your gene of interest. Please visit Michael Davidson's Molecular Expressions website for additional ...

...Nucleolus (fibrillar center) 133964 SON-mEGFP AICSDP-82 mEGFP SON Nuclear speckles 159744 DMD-mEGFP AICSDP..., Tucker A, Grancharova T, Arakaki J, Fuqua MA, Nelson A, Hookway C, Ludmann SA, Mueller IA, Yang R, Horwitz...

...eukaryotic genomes.  Components of a transposon system Transposon: The transposon is the DNA sequence that moves...also called retrotransposons, and Class II TEs, also called DNA transposons. DNA transposons are commonly...discovered transposons due to changes in coloration of corn kernels. Aside from corn, transposons are in ...2010).  So why do transposons matter? The outcome really depends on where a transposon lands. For example...components of transposons, how they are classified, and how they are used in the lab. What is a transposon? DNA...Transposable elements (TEs): Retrotransposons  Class I TEs are also known as retrotransposons. They transpose by...which are required for LTR retrotransposon transposition. Non-LTR retrotransposons contain two open reading...

...tests. All sample comparisons Do you really need to know every pairwise comparison within your population...we will dive into the nitty gritty details of comparison statistical tests – when to use them, what they...one-tailed test also works for exclusively less-than comparisons. Paired and unpaired t-tests Samples that come...family-wise error rate by only performing the comparisons you really care about. Family-wise error is the...probability of a false positive occurring when many comparisons are performed. For example, if your alpha is ...you have 5 samples and perform every pairwise comparison (10 in total), your likelihood of a false positive...higher than if you only look at 2 or 3 pairwise comparisons. Similar to family-wise error, is the false discovery...

...do an AMA in the first place and give you some reasons why you should consider using Reddit to share your... as our first foray into Reddit. Here are some reasons why: 1. Reddit has a large and active community...

...contact to connect on LinkedIn and always include a personal note about where you met and what you discussed...the near future. Even just one more meeting (in person or virtually) will make the relationship stronger... law of networking--don’t be creepy. There is a person on LinkedIn I once helped by answering one simple...not at all necessary. Once you’ve talked with a person a few times, if it was a positive experience for...was in graduate school, there was only one other person in my class who had children. When I had my baby...answered my questions and honestly, she was the only person who really understood what I was going through....

...research findings so difficult to do?  There are four reasons that research can be difficult to replicate. Unclear...with powerful cognitive biases such as motivated reasoning and hindsight bias, we may fool ourselves and ...Unanticipated discoveries Finally, there are good reasons for obtaining a different result after conducting...

...conversations on the history of the group, lessons learned, and to Sonali Roy, Magdalena Julkowska, and Jennifer... provide greater visibility of these materials, Sonali Roy, a postdoctoral researcher at the Noble Research...effort. The future of reproducibility workshops and lessons learned: Since early 2018 the team has grown to...researchers at all levels of the scientific community. Lessons learned Instead of continuously talking about...

...Zhang group. Mechanism of CRISPR-transposons One of the CRISPR-transposon systems developed by the Sternberg...aka mini-transposon), which contains the DNA cargo of interest flanked by ~50-150 bp transposon end sequences...characteristic of the Tn7-family of transposons. Insertion of the mini-transposon can occur in two different orientations...with the same transposon exhibit reduced efficiencies (Vo et al., 2020). CRISPR-transposons within the CRISPR...Lab at Columbia University Medical Center. DNA transposons are ubiquitous genetic elements capable of spreading... Beauty). Despite their diverse utility, DNA transposons have been hindered by their limited programmability...recently surpassed with the discovery of CRISPR-transposons by the Sternberg and Zhang labs (Peters et al...

...the next steps. Harvard PI Angela DePace has put personal development at the center of her lab (pictured...easily adaptable for use in your lab! Promoting personal development through thoughtful planning and honest... of in the supplement of this paper), help each person organize his or her thoughts to facilitate honest...through obstacles, and take steps to resolve interpersonal conflicts in the lab. Yearly planning meetings...hear about the steps taken in your lab to promote personal development - let us know your strategies in the... personal development...

... said Addgene’s Lianna Swanson, who has been working with members of Davidson's lab to coordinate the ...work of Michael Davidson and his colleagues." Acknowledgments Thank you to Michael Davidson, Michelle Baird...and their use for imaging cell biology, Michael Davidson’s lab at Florida State University has been the ... easily searchable format on Addgene’s Michael Davidson Fluorescent Protein Collection webpage. These...who has created plasmids as a technician in the Davidson lab for the last four years. “Researchers can ...comprehensive list of readily available targets since the Davidson lab always tagged new proteins with mEmerald first...to localize to specific cellular structures.The Davidson lab even included some of their own reference ...

...Housden BE, Perrimon N, Collins JJ, Church G (2016) Comparison of Cas9 activators in multiple species. Nat Methods...976 . https://doi.org/10.1038/nmeth.2600 Qi LS, Larson MH, Gilbert LA, Doudna JA, Weissman JS, Arkin AP...

...announce the recipients of this year’s Michael Davidson and Roger Tsien Commemorative Conference Awards...of their choice while honoring the late Michael Davidson and Roger Tsien who have played enormous roles...made some changes. In addition to supporting in-person conference attendance, the award now supports virtual... Aggarwal, and colleagues Filip Tomaska and Tim Hanson, are characterizing variants of iGluSnFR3 in vivo...

...the basics of Gibson assembly as a parody of “Breakfast at Tiffany’s.” Overview of Gibson assembly The ...The Gibson assembly technique was first described by Dr. Daniel Gibson and colleagues at the J. Craig Venter...program to design primers for Gibson Assembly. For a simple example of using Gibson assembly, imagine that you...the mixing and matching of parts. Gibson assembly meets CRISPR Gibson can be adapted to more complicated... a try! References: 1. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatic... have become more and more common, and for good reason. They offer many advantages over the traditional...disadvantages, and examples of how scientists are using Gibson assembly to put together DNA fragments. As a fun...

...but also a biological transposon system. Sleeping Beauty is a synthetic transposon system that can be used...resurrecting this transposon system? Scientists can use Sleeping Beauty transposons as a non-viral system...Now, we have meetings in rooms such as Groucho, Sonic Hedgehog, Sleeping Beauty, Cookie Monster, Spaghetti...Shivdasani Lab from the Dana Farber Cancer Institute! Sonic Hedgehog, an important regulator of embryonic development...The largest conference room at Addgene is named Sonic Hedgehog but this is not a direct reference to the...gene in animal development. To understand where sonic hedgehog got its name, we need to go back to 1980...Wiechaus, 1980). The mammalian hedgehog protein, sonic hedgehog (SHH) was named by a postdoc in Cliff Tabin...

...My son is an engineer and my daughter has a business degree. From the very start of their undergraduate...

... of sonication to avoid overheating of the sample. Mix well between rounds of sonication. Sonicate until...container pH meter Stir plate Magnetic stir bar Sonicator Ear protection Vortex Reagents Adherent HEK293T...completely. Combine all resuspended cell pellets and sonicate 5 x 1 sec pulses with at least 5 minutes on ice...

...Current Protocols in Protein Science. John Wiley & Sons, Inc. https://doi.org/10.1002/0471140864 Fox, J....

...family, he did not seem much different than my second son of similar age. When he came to visit us and watch...  Many thanks to our guest blogger Kurt Swanson! Kurt Swanson is a structural biologist and protein engineer...This post was contributed by Kurt Swanson a structural biologist and protein engineer currently working...

... a mCherry OptoNB to the catalytic domain of the Sons of Sevenless (SOS), a guanine nucleotide exchange...

...Description (Link opens in a new window) Link to Video Personal Protective Equipment (PPE) for BSL-1 and BSL-2...Cloning Add a short stretch of DNA to a plasmid Gibson Assembly Combine overlapping DNA fragments in a...

...RaLP, SHCD SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ... RHOH12 SOS1 son of sevenless homolog 1 (Drosophila) GF1, GGF1, GINGF, HGF, NS4 SOS2 son of sevenless ...Set : From Jesse Boehm , William Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type..., Hu Z, Zalocusky KA, Shankar RD, Shen-Orr SS, Thomson E, Wiser J, Butte AJ. 2018. ImmPort, toward repurposing...

... two copies of RPP30 in diploid cells, thus the reason for multiplying by 2. $$V = 2*{copies\ RRE \over...Example dilutions and titrations Reference Wang Y, Bergelson S, Feschenko M. Determination of Lentiviral Infectious...

...of how to weigh reagents. Wear the appropriate personal protective equipment (PPE) prior to handling the...

...key strategies of aseptic technique, including personal protective equipment, setting up a clean workspace...

...Centrifuge Microfuge tubes or other suitable container Personal protective equipment (PPE) appropriate for the...

...Right after entering the lab, put on the proper personal protective equipment (PPE) and wear it the whole...

...Star Activity" and can happen for a variety of reasons, including high glycerol concentration. Learn more...

...Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's Mark Cookson 13315 ...CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13318...CMV Parkinson's Mark Cookson 13319 pLenti6-DEST PINK1-V5 KD PINK1 V5 CMV Parkinson's Mark Cookson 13320...V5 CMV Parkinson's Mark Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X...His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted Dawson 17613 pRK5...GFP CMV Parkinson's Mark Cookson 25045 pDEST53-LRRK2-G2019S LRRK2 GFP CMV Parkinson's Mark Cookson 25046...GFP CMV Parkinson's Mark Cookson 25048 pDEST53-LRRK2-Y1699C LRRK2 GFP CMV Parkinson's Mark Cookson 25049...

... James M. Wilson AV-1-PV0105 105532-AAV1 pAAV.CMV.ffLuciferase.SV40 Control James M. Wilson AV-1-PV1917...James M. Wilson AV-1-PV1963 105542-AAV1 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control James M. Wilson AV-1-PV2177...James M. Wilson AV-1-PV2642 105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG Control James M. Wilson AV-1-PV2975...Control James M. Wilson AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV1963...Control James M. Wilson AV-5-PV0102 105531-AAV5 pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541...James M. Wilson AV-5-PV1963 105542-AAV5 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV2177... James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG Control James M. Wilson AV-5-PV2369...

... should be enough that they can grow out in a reasonable amount of time, but not so many that they vastly...

...Sodium azide is toxic. When handling, use proper personal protective equipment including laboratory coat...

...most proteins but more stringent buffers and a sonication step may be required for hard to extract proteins...

...* Michael Davidson 54491 mCherry-Lifeact-7 Actin Filaments LifeAct mCherry* Michael Davidson 54610 mEGFP-Lifeact...Michael Davidson 55148 mCherry-Tubulin-C-18 Microtubules alpha-tubulin mCherry* Michael Davidson 12298 ...Michael Davidson 55165 mCherry-ZO1-C-14 Tight Junctions Zonula Occludens-1 mCherry Michael Davidson 55001...TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagBFP James Johnson 13050 DsRed-Rab5... 38770 pEF.myc.ER-E2-Crimson Endoplasmic Reticulum ER retention signal E2-Crimson Benjamin Glick 36204... James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagBFP James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc...TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagBFP James Johnson 12674 GFP-rab11...

... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...

...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden ...Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc... AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Syn ChrimsonR (soma-targeted) mRuby2 Cre dependent...Adesnik 124603 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 EF1a ChrimsonR (soma-targeted) mRuby2 Cre ...9 Adesnik 124651 pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII ChrimsonR (soma-targeted) mScarlet Constitutive... Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen...

..., 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40...ffLuciferase Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH TBG none Constitutive 8 Wilson 105541 pENN.AAV.CamKII0.4...Constitutive 1, 5 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive 8 Wilson 105542 pENN.AAV.CB7..., 2, 5, 8, 9 Wilson 105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544 pENN...., PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH...Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 Wilson 105556 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...Constitutive 9 Wilson 105557 pENN.AAV.CB7.CI.mCerulean.WPRE.RBG CB7 mCerulean Constitutive 1, 9 Wilson 105598 ...

...meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson pXCas9H840A ...pyogenes Pederson pLH-nmsgRNA1.1 64115 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1...meningitidis Pederson pLH-stsgRNA2.1 64117 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1... Herold lentiGuide-Crimson 70683 Mammalian/Lentiviral hU6 none S. pyogenes Crimson Bauer BPK2660 70709...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213...Drosophila BbsI none S. pyogenes O'Connor-Giles, Harrison, Wildonger gRNA_Cloning Vector 41824 Mammalian...Worm BsaI none S. pyogenes Boxem pIK198 65629 Worm Gibson none S. pyogenes Katic pHKMC1: Empty sgRNA for ...

...Cre CMV AAV Wilson 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...GFP-Cre fusion CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH...pENN.AAV.hSyn.Cre.hGH Cre hSyn AAV Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 Cre CamKII AAV Wilson 105603 pAAV.GfaABC1D.PI.Cre.SV40...Khakh 105869 pEMS1925 iCre-ERT2 Simpson 105870 pEMS1725 iCre-ERT2 Simpson 106368 pCMV-Tag2B-NCre N-terminal...AAV.TBG.PI.Cre.rBG Cre TBG AAV Wilson 107788 AAV.rTH.PI.Cre.SV40 Cre rTH AAV Wilson 108454 mCherry-p2A-CreERT2...recombination has occurred, allowing for direct comparison of Cre+ and Cre- cells. While Cre-lox recombination...

...CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 CamKII none 1, 5, 9, rg* Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG...5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre..., rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none 1, 2, 5, 8, 9, rg* Wilson 105555 pENN.AAV.hSyn.Cre.hGH...105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre-4x6T GfaABC1D none 5 Carmichael...Carmichael 107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 ....AAV.hSyn.Cre.hGH Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato...PHPeB Larsen 107787 AAV.TBG.PI.Cre.rBGe TBG none 8 Wilson Light-Inducible Recombinases ID Name Promoter Fluorophore...

...23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer...Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere S. pyogenes 26689101 Hudson xylR...ACCATCTAATTCAACAAGAATT 73221 interfere S. pyogenes 26689101 Hudson pgi C. glutamicum TGACCGATCATTACTCAAACTTCC 74066...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2...

...105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST Cre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the ...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP ...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics...Chemogenetics expression plasmid Scott Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics...

...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. 2016. Naturally occurring off-switches...MF, Hidalgo-Reyes Y, Wiedenheft B, Maxwell KL, Davidson AR. 2015. Multiple mechanisms for CRISPR-Cas inhibition...26416740 Bondy-Denomy J, Pawluk A, Maxwell KL, Davidson AR. 2013. Bacteriophage genes that inactivate ...132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes...Cell . 159(3):647-6. PMID: 25307932 Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-...Topkar VV, Nguyen NT, Zheng Z, Gonzales AP, Li Z, Peterson RT, Yeh JR, Aryee MJ, Joung JK. 2015. Engineered...Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal...

...nerve cell function within the cell. Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive...neurodegenerative diseases include Alzheimer’s, Parkinson’s, ALS, and Huntington’s Disease. These diseases...as early-onset, where symptoms appear between a person’s thirties and mid-sixties, or late-onset, where...where symptoms appear during or after a person's mid-sixties. The early-onset form accounts for less than...created with support from the BRAIN Initiative. Jackson Laboratory (Link opens in a new window) A collection...A foundation dedicated to finding a cure for Parkinson's disease through an aggressively funded research... of improved therapies for those living with Parkinson's today. The Michael J. Fox Foundation has made...