-
-
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (EGFP) shPnky-2
Plasmid#79142PurposeStable expression of shRNA targeting mouse Pnky. The shRNA (and EGFP) can be excised by the addition of CreDepositorInsertshPnky-2 (Gm30731 Mouse)
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterU6 for the shRNA and CMV for EGFPAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.3
Plasmid#46682PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.3 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter mir16-1.1
Plasmid#46680PurposeExpresses a mutant version of the wild-type miR-16-1 in mammalian cellsDepositorInsertmir16-1.1 (MIR16-1 Synthetic, Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianMutationsee sequence and publicationPromoterCMVAvailable sinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-L4
Plasmid#62136PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA R4-R3
Plasmid#62137PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L2
Plasmid#62139PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterU6Available sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR 7SK-miR-30 R4-R3
Plasmid#62121PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR 7SK-miR-30 L1-R5
Plasmid#62118PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a 7SK RNA polymerase III promoter and miR30-based hairpin module for shRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseRNAi; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorInserthFOXH1 shRNA (FOXH1 Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterhU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
PH-Akt-GFP
Plasmid#51465PurposeIs a biosensor for PIP3/PI(3,4)P2DepositorInsertAKT (aa 1–164)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FOXA1_#1
Plasmid#70095PurposeExpression of shRNA to human FOXA1, puromycin selectionDepositorInsertFOXA1 (FOXA1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6Available sinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
shp53 pLKO.1 puro
Plasmid#19119Purpose3rd gen lentiviral vector for knocking down p53 gene expressionDepositorInsertsmall hairpin RNA against tumor protein p53 (TP53 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-hDDX5/17
Plasmid#71307PurposeInducible shRNA knockdown of both human DDX5 and DDX17 genesDepositorInsertDDX5/17 shRNA (DDX17 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterTetOAvailable sinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLacZ-1735
Plasmid#115454PurposeConstitutive lentiviral expressionDepositorInsertshLacZ-1735
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shQKI-3371
Plasmid#115455PurposeConstitutive lentiviral expressionDepositorInsertshQKI-3371 (QKI Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only
Holiday Schedule: Addgene will be closing at 1:00 pm EST on November 27th and remain closed through the 29th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
How are we doing? Share feedback for a chance to win $50
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more
