-
Plasmid#140204PurposeVector for cloning Cas9 sgRNA ( Step 1 of 2-step cloning). Contains AfU3 promoter driven sgRNA expression cassette flanked by PacI and NotI for further cloning in fungal vector.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Step 1 of cloning c…TagsExpressionMutationPromoterAspergillus fumigatus U3 (RNAPIII).Available sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only
-
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDG458 V3
Plasmid#226959PurposeCBh-SpCas9-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-smyhc1_977
Plasmid#140867PurposesgRNA synthesis vector for smyhc1_977 (zebrafish slow myosin heavy chain 1).DepositorInsertzebrafish smyhc1_977 sgRNA for in vitro transcription (smyhc1 Zebrafish, Synthetic)
UseIn vitro transcription of sgrnasTagsExpressionMutationPromoterAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHvL1P4GA
Plasmid#112028PurposeExpresses sgRNA in barleyDepositorInsertTaU6-LacZ-sgRNA
UseUnspecifiedTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-1
Plasmid#74435PurposesgRNA expression vector for mouse Dedd gene targeting intron 5DepositorInsertDedd (Dedd Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorInsertHsAGO1-sgRNA (AGO1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgDedd-2
Plasmid#74436PurposesgRNA expression vector for mouse Dedd gene targeting intron 4DepositorInsertDedd (Dedd Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
p207-Switch-ON (FRT)
Plasmid#217886PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
p206-Switch-ON
Plasmid#217885PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralTagsExpressionMammalianMutationPromoterhU6Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B9
Plasmid#172850PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B9 (Zhong et al, eLife 2021), mEGFP translational phase (2-2), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-2) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B8
Plasmid#172849PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B8 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 1-1) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330 _CRISPIE donor B10
Plasmid#172851PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B10 (Zhong et al, eLife 2021), mEGFP translational phase (2-stop), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and CRISPIE designer exon (phase 2-stop) encoding mEGFP
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only