We narrowed to 9,058 results for: sgRNA
-
Plasmid#254583PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and capture sequence in scaffold and mCherry from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJZC593
Plasmid#62319PurposesgRNA with MS2-PP7 for yeast cellsDepositorInsertsgRNA + MS2-PP7 RNA binding module
ExpressionYeastPromoterSNR52Available sinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector
Plasmid#132560PurposeVector plasmid expressing ABEmax and sgRNA scaffold with com replacing the Tetraloop.DepositorInsertsABEmax
sgRNA, with Tetraloop replaced by com aptamer
ExpressionMammalianPromoterCMVAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SpyCas9-TLR-MCV1-sgRNA1
Plasmid#117405PurposeSpyCas9 sgRNA 1 targeting TLR2.0DepositorInsertSpyCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA
Plasmid#191528PurposeVector for tandem expression of SLBP 3'UTR G1 sgRNA in combination with ATP1A1 G3 sgRNA from two independent U6 promoters to facilitate SLBP endogenous tagging by marker free coselection using ouabainDepositorInsertSLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available sinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
(pRZ318) AAV: U6-gRNA(FLEX)-EF1a-mScarlet
Plasmid#254587PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and mScarlet from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
(pRZ320) AAV: U6-gRNA(FLEX)-EF1a-ZsGreen
Plasmid#254588PurposeAAV backbone expressing a U6-driven sgRNA with SapI spacer and 10x FLEX preferred scaffold and ZsGreen from the EF1a promoterDepositorInsertsgRNA with SapI spacer
UseAAVAvailable sinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMPC2_7
Plasmid#163457Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 7 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPR-v1-sgMPC2_9
Plasmid#163458Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 9 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiGuideFB-Puro-A
Plasmid#192506PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInserthU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterhU6Available sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2645
Plasmid#229529PurposeCarries mIAA7_opt tag, empty sgRNA, and NATR markerDepositorInsertmIAA7_opt - empty sgRNA - NATR
UseCRISPRTags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBHM2646
Plasmid#229530PurposeCarries mAID_opt tag, empty sgRNA, and NATR markerDepositorInsertmAID_opt - empty sgRNA - NATR
Tags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBHM2651
Plasmid#229993PurposeCarries AID* tag, empty sgRNA, and NEOR markerDepositorInsertAID* - empty sgRNA - NEOR
Tags2xFLAGExpressionBacterial and YeastAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable sinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LCV2 IRF3 KO
Plasmid#217446PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3DepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only