-
Plasmid#153472PurposeMammalian expression of FLAG-tagged TAPBPR with tapasin CT delta24-36DepositorInsertTAPBPR (TAPBPL Human)
UseTagsFLAGExpressionMammalianMutationC terminal tail of tapasin, deletion of amino aciā¦PromoterCMVAvailable sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-N-Myc-Flag-BirA-hPOT1-DeltaOB
Plasmid#166410Purposeexpress BirA-hPOT1 ĪOB in mammalian cellsDepositorInsertPOT1 ĪOB (POT1 Human)
UseTagsMYC-flag-BirAExpressionMammalianMutationĪOBPromotercmvAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pDEST26-MSRA-C-HA
Plasmid#195177PurposeVector for transient expression of MSRA gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorInsertMSRA (MSRA Human)
UseTagsHAExpressionMammalianMutationPromoterCMV promoterAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro
Plasmid#208646PurposepcDNA3.1 based empty vector for transient transfection of sgRNA-cas9. U6 promoter ~ puro Res cloned from lentiCRISPRv2 (Addgene#52961), lenti virus sequences not included.DepositorTypeEmpty backboneUseCRISPRTagsClawed frog nucleoplasmin NLS, Flag, Puromycin reā¦ExpressionMammalianMutationPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST26-PPP2CB-C-HA
Plasmid#195179PurposeVector for transient expression of PPP2CB gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorInsertPPP2CB (PPP2CB Human)
UseTagsHAExpressionMammalianMutationPromoterCMV promoterAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
UVR8-mCherry
Plasmid#49804Purposeexpresses mCherry fused to UVR8 under the CMV promoterDepositorInsertUVR8-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE-PtenC124S-Blast
Plasmid#135675PurposeDox-inducible expression (TRE promoter) of C124S mutant Pten cDNA, Blasticidin selectionDepositorInsertPten (Pten Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_D2A_tdTomato
Plasmid#184045PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)DepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Dual 2A Peptide Sequence
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
L1-neo-TET
Plasmid#51284Purposeexpresses codon optimized human L1 retrotransposon driven by CMV promoter and tagged with the self splicing intron neo cassetteDepositorInsertL1RE1 (L1RE1 Human)
UseTagsneoTET cassette with a tetrahymena self-splicing ā¦ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV sgRNA Expression Plasmid
Plasmid#174540PurposeContains restriction sites to clone in U6 promoter and sgRNA oligo. CMV-driven mCherry fluorescent marker.DepositorTypeEmpty backboneUseAAVTagsNoneExpressionMammalianMutationPromoterCMVAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 F-tractin-EGFP
Plasmid#58473PurposeExpresses a cytoplasmic actin filament reporter, the neuronal inositol 1,4,5-triphosphate 3-kinase A actin-binding domain known as F-tractin, on a CMV promoterDepositorInsertF-tractin (Itpka Rat)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CRBN-P2A-Hygro
Plasmid#124303PurposeLentiviral vector for expression of Flag tagged CRBN-P2A-Hygro casette from a CMV promoterDepositorInsertCRBN (CRBN Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_IRES_tdTomato
Plasmid#184046PurposeExpresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using an IRES sequenceDepositorInsertsEnhanced Green Fluorescent Protein
tdTomato
Internal Ribosome Entry Site
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-CUL4A WT-P2A-Puro
Plasmid#124304PurposeLentiviral vector for expression of wild-type CUL4A-P2A-Puro casette from a CMV promoterDepositorInsertCUL4A (CUL4A Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targetiā¦PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCL1318
Plasmid#217960PurposeExpression of human H4 carrying three point mutations to disrupt binding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
UseTagseGFPExpressionMammalianMutationL63A, F66A, I71APromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCL1317
Plasmid#217959PurposeExpression of human H4 carrying a triple glycine insertion to disrupt folding with H3. Expression in mammalian cells driven by the CMV promoter.DepositorInsertHistone H4 (H4C1 Human)
UseTagseGFPExpressionMammalianMutationGGG insertion between V65 and F66PromoterCMVAvailable sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PGUS
Plasmid#207827PurposeFLAG-tagged PGUS driven by CMV promoterDepositorInsertPGUS
UseLentiviralTagsFLAGExpressionMutationPromoterCMVAvailable sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only