-
Plasmid#193618PurposeHec1 heavy chain variable and constant region (mouse) + exogenous N-term signal peptide. For co-expression with pDL002 in HEK293 cells.DepositorInsertAnti-Hec1 Heavy Chain (Hec1-ms_IgG_HC)
UseTagsHis6 and signal peptideExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDL002_Hec1-ms_IgG_LC
Plasmid#193619PurposeHec1 light chain variable and constant region (mouse) + exogenous N-term signal peptide. For co-expression with pDL001 in HEK293 cells.DepositorInsertAnti-Hec1 light chain (Hec1-ms_IgG_LC)
UseTagssignal peptideExpressionMammalianMutationPromoterCMVAvailable sinceDec. 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJCC_103 SpCas9 T1337C
Plasmid#179525PurposeFor bacterial expression of SpCas9 T1337C (for DNA cross-linking) with an N-terminal His-MBP tagDepositorInsertSpCas9 T1337C
UseTags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged threonine 1337 to cysteinePromoterAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA27_no stop
Plasmid#83860PurposeGateway donor vector for IAA27 with no stop codonDepositorInsertIAA27 (PAP2 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA8_no stop
Plasmid#83874PurposeGateway donor vector for IAA8 with no stop codonDepositorInsertindole-3-acetic acid inducible 8 (IAA8 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA5_no stop
Plasmid#83868PurposeGateway donor vector for IAA5 with no stop codonDepositorInsertIAA5 (IAA5 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA3_no stop
Plasmid#83863PurposeGateway donor vector for IAA3 with no stop codonDepositorInsertIAA3 (SHY2 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA10_no stop
Plasmid#83848PurposeGateway donor vector for IAA10 with no stop codonDepositorInsertindoleacetic acid-induced protein 10 (IAA10 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA4_no stop
Plasmid#83866PurposeGateway donor vector for IAA4 with no stop codonDepositorInsertIAA4 (ATAUX2-11 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA28_no stop
Plasmid#83861PurposeGateway donor vector for IAA28 with no stop codonDepositorInsertNP_568478.1 (IAA28 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-IAA15_no stop
Plasmid#83853PurposeGateway donor vector for IAA15 with no stop codonDepositorInsertindole-3-acetic acid inducible 15 (IAA15 Mustard Weed)
UseGateway donor vectorTagsExpressionMutationno stop codonPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1363 LV EF1a-CD19 IRES-EGFP
Plasmid#201919Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD19DepositorInsertCD19 (CD19 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Klf2-t2A-mCherry
Plasmid#127539PurposeExpresses mouse Klf2 and mCherry via t2A linker.DepositorInsertKlf2 (Klf2 Mouse)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceOct. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-p58
Plasmid#166942Purposemammalian expression of p58 (ie ERGIC-53; LMAN1) tagged with GFPDepositorInsertp58 (Lman1 Rat)
UseTagsGFP and chicken lysozyme signal peptideExpressionMammalianMutationPromoterCMVAvailable sinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1365 LV EF1a-CD28 IRES-EGFP
Plasmid#201921Purpose2nd generation lentiviral transfer plasmid for engineering cells to express human CD28DepositorInsertCD28 (CD28 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-Sec61b-C1
Plasmid#90994PurposeExpresses mCherry-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmCherry-Sec61b (SEC61B Human, Synthetic)
UseTagsmCherry (red fluorescence)ExpressionMammalianMutationPromoterCMVAvailable sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-PS9
Plasmid#177944PurposeTransient mammalian expression of eGFP along with SARS-CoV-2 sequence 20080-21171 (PS9) within the 3'UTR. Resulting transcript is packaged into SARS-CoV-2 virus-like particles.DepositorInserteGFP (ORF1ab )
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH051
Plasmid#171625Purpose2nd generation lentiviral transfer plasmid encoding a U6 promoter expressing a spyCas9 sgRNA (no spacer, BsmBI cutsites) and an EF1-a promoter expressing mNeonGreenDepositorInsertsspyCas9 sgRNA-BsmBI-Destination
mNeon
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1-a and U6Available sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-Sec61b-C1
Plasmid#90992PurposeExpresses mEmerald-tagged Sec61b, brightly labels endoplasmic reticulum in mammalian cellsDepositorInsertmEmerald-Sec61b (SEC61B Human, Synthetic)
UseTagsmEmerald (green fluorescence)ExpressionMammalianMutationPromoterCMVAvailable sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only