-
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ)-sgRNA_entry (CJT111)
Plasmid#181790PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-BFP-hCYP3A4-enhancer-R-sgRNA
Plasmid#176841PurposeTargeting human CYP3A4 proximal enhancer right boundary. sgRNA expressing cells could be FACS sorted by BFP expression.DepositorInsertHuman CYP3A4 proximal enhancer right boundary
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
330-cherry-hCYP3A4-enhancer-L-sgRNA
Plasmid#176840PurposeTargeting human CYP3A4 proximal enhancer left boundary. sgRNA expressing cells could be FACS sorted by cherry expression.DepositorInsertHuman CYP3A4 proximal enhancer left boundary
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330.puro sgRNA KGA Stop1
Plasmid#110405PurposeCRISPR/Cas9 vector with sgRNA for glutaminase KGA isoform C-Terminal Knock-in and puromycin resistanceDepositorInsertGLS glutaminase (GLS Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI733 pRPR1(TetO)-RPC31-sgRNA
Plasmid#164913PurposeFor yeast genomic integration of sgRNA against RPC31DepositorInsertpRPR1(TetO)-RPC31-sgRNA
UseCRISPRTagsExpressionYeastMutationPromoterRPR1Available sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNTI732 pRPR1(TetO)-HTS1-sgRNA
Plasmid#164912PurposeFor yeast genomic integration of sgRNA against HTS1DepositorInsertpRPR1(TetO)-HTS1-sgRNA
UseCRISPRTagsExpressionYeastMutationPromoterRPR1Available sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-5U6-sgRNAs-hsyn-EGFP
Plasmid#112213PurposeTargeted DNA methylationDepositorInsertsgRNAs
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Spa)_gcrA3
Plasmid#133343Purposefor constitutive expression of a single guide RNA from Streptococcus pasteurianus with a seed region that targets gcrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRTagsExpressionMutationPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133345Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets blaA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_blaA
UseCRISPRTagsExpressionMutationPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for flox targeting)
Plasmid#110815PurposeUsed with pNTK Gatad2a flox allele targeting construct in mouse cellsDepositorInsertmGataD2a (Gatad2a Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
Plasmid#114730PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M7
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-IRES-CFP
Plasmid#114728PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA2
Plasmid#133341Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRTagsExpressionMutationPromoterconstitutiveAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pX601 miniCMV-SaCas9-SpA-sgRNA scaffold
Plasmid#107055PurposeBackbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)DepositorTypeEmpty backboneUseAAV and CRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
B52 (empty plasmid backbone to express 2 sgRNAs)
Plasmid#100708PurposeEmpty plasmid backbone to express 2 sgRNAs (use BbsI and BsmBI for cloning)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable sinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only