-
Plasmid#164695PurposeExpression of PRMT3 with an N-terminal FLAG tagDepositorInsertPRMT3 (PRMT3 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hSK
Plasmid#27078PurposeIntegration-free (episomal) expression of human SOX2 and KLF4DepositorUseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe D6
Plasmid#197577PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe D6 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
UseTagsNuclear export sequence + FLAGExpressionMammalianMutationN311A, C313M, V366G, W382TPromoterCMV and U6/H1Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-Fluoro-Phe B5
Plasmid#197576PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe B5 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cellsDepositorInsertsMb Pyl Fluoro-Phe B5 synthetase
Pyl-tRNA (4 copies)
UseTagsNuclear export sequence + FLAGExpressionMammalianMutationN311G, C313APromoterCMV and U6/H1Available sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
DENV4 Rluc Reporter GND mutant Replicon
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424TagsExpressionMutationThe conserved GDD in the NS5 polymerase gene muta…PromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSC-NGN2-IRES-GFP-T2A-Sox11
Plasmid#90214PurposeTo convert human skin fibroblasts into induced motor neurons (hiMN) in combination with ISL1, LHX3, FGF2 and two small molecules, forskolin and dorsomorphin.DepositorUseLentiviralTagsExpressionMutationPromoterCMVAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCherry.90 alpha
Plasmid#108222PurposeMammalian expression vector for mCherry fusion to human Hsp90 alphaDepositorInsertmCherry-Hsp90a (HSP90AA1 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#7 in pTwist-CMV backbone
Plasmid#216152PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. This plasmid has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells. It uses a cryptic exon. [Code 'A11']DepositorInsertmScarlet with cryptic exon and C-terminal FLAG
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe K-Ras 12V
Plasmid#12544DepositorInsertK-Ras 12V (KRAS Human)
UseRetroviralTagsExpressionMammalianMutation12V constituitively activatedPromoterAvailable sinceSept. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-IKBalpha-mut (super repressor)
Plasmid#15291DepositorInsertinhibitor of Kappa B alpha (NFKBIA Human)
UseRetroviralTagsExpressionMammalianMutationS32A/S36A: “super-repressor” allele (resistant to…PromoterAvailable sinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBabe-GFP-IKBalpha-mut (super repressor)
Plasmid#15264DepositorInsertIKB alpha (NFKBIA Human)
UseRetroviralTagsExpressionMammalianMutationSerine 32 to Alanine, Serine 36 to AlaninePromoterAvailable sinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP-v2 IQSEC1 WT
Plasmid#162017PurposeExpression of IQSEC1 splice variant 2DepositorInsertIQSEC1 (IQSEC1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pLEX304-GFP-v1 IQSEC1 WT
Plasmid#162016PurposeExpression of IQSEC1 splice variant 1DepositorInsertIQSEC1 (IQSEC1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL A WT
Plasmid#202413PurposeExpression of GFP-tagged PODXL (isoform A) WTDepositorInsertPODXL (PODXL Human)
UseLentiviralTagsGFPExpressionMutationPromoterAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TDP-REGv2(mScarlet-FLAG)#9 in pTwist-CMV backbone
Plasmid#216153PurposeExpresses mScarlet in cells with TDP-43 loss-of-function. Has one of the best dynamic ranges of those tested (~100-fold) in SK-N-BE2 cells (brighter than #7). It uses a single intron. [Code 'B11'].DepositorInsertmScarlet with cryptic splice site and C-terminal FLAG tag
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP-v3 IQSEC1 WT
Plasmid#162018PurposeExpression of IQSEC1 splice variant 3DepositorInsertIQSEC1 (IQSEC1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP-v4 IQSEC1 WT
Plasmid#162019PurposeExpression of IQSEC1 splice variant 4DepositorInsertIQSEC1 (IQSEC1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only