-
Plasmid#171101PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Olig2.DepositorInserthSpCas9 (Olig2 Mouse, S. pyogenes)
UseCRISPRTagsExpressionMutationPromoterEf1aAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.V5_mCherry-NLS
Plasmid#178215PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorInsertPLK1 (PLK1 Human)
UseCRISPR and LentiviralTagsBFPExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMbCas12a-NLS(nucleoplasmin)-3xHA (AAS2134)
Plasmid#114090PurposeCAG promoter expression plasmid for human codon optimized MbCas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized MbCas12a
UseTagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT526
Plasmid#180513PurposePlasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv1
PlmCasX-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianMutationPromoterCAG and U6Available sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
BE3(E63Q)-P2A-EGFP (pRZ189)
Plasmid#123613PurposeCAG promoter expression plasmid for rAPOBEC1(E63Q)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP (catalytically impaired BE3 mutant).DepositorInsertBE3(E63Q)-P2A-EGFP
UseTagsExpressionMammalianMutationE63Q in rAPOBEC1, D10A in SpCas9PromoterCAGAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE3328
Plasmid#107539PurposeExpresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells.DepositorInsertsAs crRNA
hAsCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationS542R, K607RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorInserthSpCas9 (Otx2 Mouse, S. pyogenes)
UseCRISPRTagsExpressionMutationPromoterEf1aAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE3329
Plasmid#107538PurposeExpresses Lb crRNA and human codon optimized LbCpf1(RR mutant) in mammalian cells.DepositorInsertsLb crRNA
hLbCpf1(RR mutant)
UseTags3xHA, NLS, and SV40 NLSExpressionMammalianMutationG532R, K595RPromoterCMV and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only