-
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
UseTagsExpressionYeastMutationPromoterAvailable sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
hAID-BE3 (pRZ352)
Plasmid#131316PurposeCAG promoter expression plasmid for hAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthAID-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-NLC-DHFR-SpCas9
Plasmid#124523PurposeExpresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cellsDepositorInsertNLC-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianMutationPromoterCbhAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC010 LshCas13a locus with nontargeting spacer
Plasmid#91901PurposeLshCas13a locus into pACYC184 with nontargeting spacerDepositorInsertLshCas13a locus with non-targeting spacer
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 16, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
-
-
BPK3274 - human expression plasmid for eSpCas9(1.1)-HF1
Plasmid#101177PurposeHuman expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant: CMV-T7-hSpCas9-eSpCas9(1.1)-HF1(N497A, R661A, Q695A, K848A, Q926A, K1003A, R1060A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-eSpCas9(1.1)-HF1(N497A/R661A/Q695A/K848A/Q926A/K1003A/R1060A)
UseTags3x FLAG and NLS (SV40)ExpressionMammalianMutationN497A/R661A/Q695A/K848A/Q926A/K1003A/R1060APromoterCMVAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS3
Plasmid#140626PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS3. The crRNA-IS3 targets IS3 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS3
UseCRISPR; TransposonTagsExpressionBacterialMutationPromoterAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7780 mU6:- || CMV: mCherry~P2A-DD-AcrIIA4
Plasmid#123658PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control without sgRNA following mU6 promoter.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromotermU6Available sinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
UseTags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationD917A and E1006A mutations to inactivate the endo…PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp63-Exon4-1sgRNA
Plasmid#88848PurposeCRISPR KO of Trp63DepositorInsertTrp63 (Trp63 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK669
Plasmid#192638PurposeExpresses dxCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dxCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyTagsExpressionMutationSoxS has R93A and S101A mutations and dxCas9-NG h…PromoterBBa_J23107 and Sp.pCas9Available sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pCRI011-pYFAC-pyroA-PgpdA-4xcrRNAarrayelcA-TtrpC
Plasmid#140203PurposeFungal vector to express an LbCas12a crRNA array targeted to Pelca, to be contransformed with pCRI009 containing PelcA-mCherry in a dLbCas12a-VPR strain as proof-of-concept of CRISPRa.DepositorInsertcrRNA array elcA
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPgpdAAvailable sinceSept. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only