-
Plasmid#163169PurposeLentiviral plasmid with non-targeting gRNA, co-expression of BFP tagDepositorInsertNon-targeting
UseCRISPR and LentiviralTagsBFPExpressionMammalianMutationPromoterU6Available sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK341
Plasmid#192640PurposeExpresses dSpRY and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dSpRY
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyTagsExpressionMutationSoxS has R93A and S101A mutations and dSpRY has s…PromoterBBa_J23107 and Sp.pCas9Available sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC620
Plasmid#62282PurposeExpresses dCas9, MCP-VP64, and PCP-VP64 in Yeast cellsDepositorInsertsMCP-VP64
PCP-VP64
dCas9
UseTagsVP64ExpressionYeastMutationNuclease activity has been inactivated by mutatio…PromoterpAdh and pTdh3Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#113398Purposeexpresses gRNA for Cas9 FRT targettingDepositorInsertexo, beta, gam, sgRNA-FRT
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJSC282 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variant
Plasmid#101231PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), REC3 FRET variantDepositorInsertSpCas9 variant C80S/C574S/S701C/S960C/N692A/M694A/Q695A/H698A
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S701C, S960C, N692A, M694A, Q695A an…PromoterT7Available sinceNov. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJK-caCas9-NatMX-Neut5L-Ade2 drive
Plasmid#89577PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Ade2 locusDepositorInsertAde2 gene drive
UseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTE4495
Plasmid#80338Purposemammalian expression MbCpf1 nuclease and Mb crRNADepositorInsertsMb crRNA
MbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianMutationPromoterCMV and human U6Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonTagsExpressionBacterialMutationPromoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-gfap-sgRNA
Plasmid#65566Purposein vitro trancription of sgRNA targeting the zebrafish gfap locusDepositorInsertgfap sgRNA (gfap Zebrafish)
UseIn vitro rna transcriptionTagsExpressionMutationPromoterT7Available sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
HP-Cas9hGem-Ade2-LEU2-LINEAR
Plasmid#174839PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorphaDepositorInsertHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
UseCRISPR and Synthetic BiologyTagsExpressionBacterial and YeastMutationPromoterTDH3pAvailable sinceJan. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJGL002
Plasmid#180606PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasXDepositorInsertPlmCasX
UseCRISPRTags10xHis and MBPExpressionBacterialMutationPromoterT7Available sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Cas9-RFC5
Plasmid#183200PurposeEntry cloneDepositorInsertCas9-RFC5
UseCRISPR; Gateway entry cloneTagsExpressionMutationn/aPromoterAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMb3Cas12a-NLS(nucleoplasmin)-3xHA (RTW2500)
Plasmid#115142PurposeCAG promoter expression plasmid for human codon optimized Mb3Cas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized Mb3Cas12a
UseTagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
H517 SONIC HRASV12 donor
Plasmid#138177PurposeCRISPR SONIC: HRAS G12V donor plasmidDepositorInsertHRASV12 (HRAS Human)
UseNhej donorTagsExpressionMutationPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only