Showing: 9821 - 9840 of 16040 results
-
Plasmid#202214PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertpBCC25, pBCC33, pBCC56, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC088
Plasmid#202215PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertpBCC25, pBCC33, pBCC58, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC089
Plasmid#202216PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and tagBFP fluorescent markerDepositorInsertpBCC25, pBCC33, pBCC59, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC090
Plasmid#202217PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertpBCC25, pBCC33, pBCC57, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC092
Plasmid#202219PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and AmCyan1 fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC56, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC093
Plasmid#202220PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and tagRFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC58, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC096
Plasmid#202222PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC57, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pBCC097
Plasmid#202223PurposeLevel 2 empty backbone for strain-specific barcode DNA tag through Tn7 bacterial insertion, Tetracyline selectable marker and tagBFP fluorescent markerDepositorInsertpBCC25, pBCC30, pBCC59, pBCC27, pBCC26, pBCC28, pICH41822 (G5)
UseTagsExpressionBacterialMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-CoV-2-HiBiT-N
Plasmid#215815PurposeExpresses N protein with HiBiT tag in mammalian cellsDepositorInsertSARS-CoV-2 HiBiT Nucleocapsid (N )
UseTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1-FAK-HA-V744G
Plasmid#35040DepositorInsertfocal adhesion kinase (Ptk2 Mouse)
UseTags2x HA and mCherryExpressionMammalianMutationGFP-FAK-V744G was generated from GFP-FAK using th…PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-hMcl-1(S159A)
Plasmid#25374DepositorInserthMCL1(S159A) (MCL1 Human)
UseTagsV5 and His tagExpressionMammalianMutationchanged serine 159 to alaninePromoterAvailabilityAcademic Institutions and Nonprofits only -
p1G108CFa
Plasmid#85089PurposeExpresses PCNA1 variant (G108C) fused to an FAD domain of P450 BM3 (A74G/C773S/C810S) in E. coliDepositorInsertThe G108C variant of PCNA1 fused to an FAD domain of P450 BM3
UseTagsHis6 tagExpressionBacterialMutationG108C in PCNA1, A74G/C773S/C810S in FAD domain of…PromoterT7 promoterAvailabilityAcademic Institutions and Nonprofits only -
p3R112C/T180CBM3
Plasmid#85090PurposeExpresses PCNA3 variant (R112C/T180C) fused to P450 BM3 variant (A74G/C773S/C810S) in E. coliDepositorInsertThe R112C/T180C variant of PCNA3 fused to P450 BM3
UseTagsHis6 tagExpressionBacterialMutationR112C/T180C in PCNA3, A74G/C773S/C810S in P450BM3PromoterT7 promoterAvailabilityAcademic Institutions and Nonprofits only -
pSLIK TT 3xFLAG SMAD4 neo
Plasmid#83273PurposeLentiviral vector for inducible expression of SMAD4 with 3xFLAG N-terminal tagDepositorInsertSMAD4 (SMAD4 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pLX302-MKP5-V5 puro
Plasmid#87770PurposeExpresses V5 tagged human MAPK phosphatase 5 (MKP5/DUSP10)DepositorInsertMKP5 (DUSP10 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pLX302-MKP7-V5 puro
Plasmid#87771PurposeExpresses V5 tagged human MAPK phosphatase 7 (MKP7/DUSP16)DepositorInsertMKP7 (DUSP16 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pLX302-DUSP19-V5 puro
Plasmid#87772PurposeExpresses V5 tagged human DUSP19DepositorInsertDUSP19 (DUSP19 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1 (-) + SLNCR1 + 12x MS2 bs
Plasmid#86828PurposeExpression of SLNCR1 lncRNA tagged with 12 copies of the MS2 stem-loop sequenceDepositorInsertLINC00673 (LINC00673 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCINeoFlag ALIX; I212D
Plasmid#89861PurposeExpresses full length Flag-tagged ALIX with mutation I212D in mammalian cells; internal ID WISP05-117DepositorInsertALIX (PDCD6IP Human)
UseTagsFlagExpressionMammalianMutationMutated isoleucine 212 to aspartic acidPromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 9821 - 9840 of 16040 results