-
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_FOXP1
Plasmid#86261PurposeDonor vector for 3' FLAG tag of human FOXP1DepositorInsertFOXP1 homology arms (FOXP1 Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dRanCas13b-EGFP-NLS-3xFlag
Plasmid#132409Purposeoverexpression in human cellsDepositorInsertdRanCas13b
UseLentiviralTagsflagExpressionMammalianMutationH147A; H1044APromoterAvailable sinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dPspCas13b-mNeongreen-NLS-3xFlag
Plasmid#132401Purposeoverexpression in human cellsDepositorInsertdPspCas13b
UseLentiviralTagsflagExpressionMammalianMutationH133A; H1059APromoterAvailable sinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain
Plasmid#101205PurposeBacterial expression plasmid for SpCas9 REC3 domainDepositorInsertSpCas9 variant K506–Q712
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationK506–Q712PromoterT7Available sinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC518
Plasmid#62277PurposeYeast dCas9 expression plasmidDepositorInsertdCas9
UseTagsExpressionYeastMutationHas mutations in the RuvC1 and HNH domains to ren…PromoterpTdh3Available sinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dLbaCas13a-EGFP-NLS-3xFlag
Plasmid#132408Purposeoverexpression in human cellsDepositorInsertdLbaCas13b
UseLentiviralTagsflagExpressionMammalianMutationR600A; H605A; R1243A; H1248APromoterAvailable sinceJan. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-mH6-Cas12i2
Plasmid#120883PurposeExpresses E. coli codon optimized Cas12i2 effector in the pET28a backbone.DepositorInsertCas12i2
UseCRISPRTagsmH6ExpressionBacterialMutationWTPromoterlacAvailable sinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_TUBA1B sgRNA / hSpCas9
Plasmid#172834PurposeMammalian expression of a sgRNA targeting the intron 1 of TUBA1B (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of TUBA1B under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
Plasmid#140202PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.DepositorInsertmCherry
UseCRISPR and Synthetic Biology; Proof-of-concept te…TagsExpressionMutationG174DPromoterPelcAAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-KKHSaCas9-BlastR
Plasmid#107189PurposeConfers constitutive expression of KKH SaCas9.DepositorInsertKKH SaCas9 (NEWENTRY )
UseTagsExpressionBacterialMutationE782K/N968K/R1015HPromoterChicken ß-ActinAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS3: pHelper(AvCAST)_AvPSP1_ΔTnsD
Plasmid#168135PurposeInducible expression of AvCAST proteins (except TnsD) with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC519
Plasmid#62278PurposeYeast dCas9-VP64 expression plasmidDepositorInsertdCas9-VP64
UseTagsHas a VP64 fusionExpressionYeastMutationHas mutations in the RuvC1 and HNH domains to ren…PromoterpTdh3Available sinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8
Plasmid#136376PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 3.8 is usedDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CEBPG
Plasmid#86285PurposeDonor vector for 3' FLAG tag of human CEBPGDepositorInsertCEBPG homology arms (CEBPG Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
Plasmid#140201PurposeFungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Cloning of crrna an…TagsdLbCas12a crRNA scaffoldExpressionMutationPromoterPgpdAAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only