-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mPLD3-sgRNA-Cas9-mcherry
Plasmid#199700Purposeencodes sgRNA for mouse PLD3 KO, (target 217-223aa) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9
Plasmid#49330PurposeExpresses sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertsCas9
dU6-sgRNA
UseCRISPRTags3xFLAG and NLSExpressionInsectMutationHuman codon optimisedPromoterActin-5c and Drosophila U6Available sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-GFP-U6-gRNA
Plasmid#79144PurposeAll-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSCDepositorInsertSpCas9
UseCRISPRTags2A-GFPExpressionMammalianMutationPromoterCAGAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MP-84-spCas9-U6-gRNA-tlock
Plasmid#206936PurposeExpression of spCas9 endonuclease and gRNA in an AAV vector allowing packaging of viral genome smaller than 5 kb.DepositorInsertspCas9
UseAAVTagsSV40 NLSExpressionMammalianMutationPromoterMP-84Available sinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA NC
Plasmid#176259PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and spacer sequence on sgRNA is replaced by the type IIS restriction site for endonuclease BaeI andDepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (empty, donor)
Plasmid#80768PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
SaCas9_sgRNA_expression_in_pBluescript
Plasmid#122090PurposeU6 driven SaCas9 sgRNA expression vector for cloning own guidesDepositorInsertSaCas9 tracr (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cas9-gRNA-GFP
Plasmid#124770Purpose3rd generation lentiviral plasmid encoding Cas9, GFP, and a gRNA backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cas9-gRNA-TagBFP2
Plasmid#124774Purpose3rd generation lentiviral plasmid encoding Cas9, TagBFP2, and a gRNA backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianMutationPromoterLP1B and hU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationH840A and D10A mutations on spCas9 to inactivate …PromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td1
Plasmid#176257PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 1DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseExpressionMutationPromoterAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_CNRZ1066
Plasmid#136651PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:CNRZ_1066 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianMutationPromoterCAG and hU6Available sinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only