-
Plasmid#136261PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagssTomato-NLSExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mNeonGreen-NLS. PGK-puro
Plasmid#136262PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmNeonGreen-NLSExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP-Puro-TetOn-L1RP-ORF1_StammerAAA_Halo-GFPai
Plasmid#202571PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the M91A, E92A, and L93A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
UseTagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…PromoterAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha A-crystallin 1kb promoter/AcGFP
Plasmid#98096PurposeaA-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha A-crystallin promoter 1 kb fragment, Danio rerio (cryaa Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha A-crystallin 1 kb fragment (-1028/-1)Available sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mScarletI-NLS. PGK-puro
Plasmid#136263PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmScarletI-NLSExpressionMammalianMutationPromoterAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Stat1 alpha Y701F Flag pRc/CMV
Plasmid#8702DepositorInsertSTAT1 alpha Y701F (STAT1 Human)
UseTagsFlagExpressionMammalianMutationY701FPromoterAvailable sinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSEM237 - pEXP[Prpl-3 | histamine | rpl-3 UTR]
Plasmid#159796PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Prpl-3 | histamine | rpl-3 UTR]
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2 stabilized mutant Beta Catenin-GFP
Plasmid#29684DepositorInsertbeta catenin (ctnnb1.L Frog)
UseTagsGFPExpressionMammalianMutationS33A, S37A, T41APromoterAvailable sinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_ISG15
Plasmid#99322PurposeLuciferase validation vector with ISG15 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr1: 947976 -949995 (ISG15 Human)
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_OAS3
Plasmid#99324PurposeLuciferase validation vector with OAS3 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr12: 94575894 -94578286
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationG44SPromoterAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LV_EF1a_Stat3(A662C,N664C,V667L)-P2A-Hygro_Barcode
Plasmid#170254PurposeBarcoded lentiviral vector to express Stat3 (A662C, N664C, V667L) in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seqDepositorInsertSTAT3 (STAT3 Human)
UseLentiviralTagsExpressionMutationA662C, N664C, V667LPromoterEF1aAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFI27
Plasmid#99320PurposeLuciferase validation vector with IFI27 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr14: 94575894-94578286
UseLuciferase; Starr-seq luciferase validation vectorTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
LO601: pMVP (R4-R3) destabilized firefly luciferase (Luc2P)
Plasmid#132926PurposepMVP R4-R3 entry plasmid, contains destabilized Firefly Luciferase (Luc2P) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertLuc2P
UseLuciferase and Synthetic Biology; Pmvp gateway en…TagsPEST destabilization domainExpressionMutationPromoterAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pALPS_3'LTR GFP@gag start SFFV-
Plasmid#101337PurposeRepaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.DepositorInsertGFP
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM236 - pEXP[Pmlc-2 | histamine | rpl-3 UTR]
Plasmid#159797PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Pmlc-2 | histamine | rpl-3 UTR]
UseTagsExpressionWormMutationNot applicablePromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseTagsExpressionMutationincludes distal fragment of human frataxin promot…PromoterAvailable sinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DNL-CMV-GFP
Plasmid#83253PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralTagsExpressionMutationC-terminal deletion of 351 nucleotides (dominant …PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Bb-crystallin 1kb promoter/AcGFP
Plasmid#98098PurposeaBb-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Bb-crystallin promoter 1 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio aBb-crystallin 1 kb fragment (-1074/-1)Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only