-
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available sinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
MTRAP-bio
Plasmid#47746PurposeExpresses enzymatically monobiotinylated full-length MTRAP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MTRAP
UseTagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable sinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-Epac1 CAAX
Plasmid#118312PurposeExpression of human Epac1DepositorInsertEpac1 CAAX (RAPGEF3 Human)
UseTagsGFPExpressionMammalianMutationC-terminal 20aa of KiRasPromoterCMVAvailable sinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
ABE8.13-m
Plasmid#136296Purposeexpresses ABE8.13-m in mammalian cellsDepositorInsertABE8.13-m
UseTagsC-terminal BPNLSExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterAvailable sinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNAz-mBACEflag (C474A/C478A/C482A/C485A)
Plasmid#26736DepositorInsertBACE (Bace1 Mouse)
UseTagsFLAGExpressionMammalianMutationCys 474, 478, 482, and 485 mutated to AlaPromoterAvailable sinceDec. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb6-flag
Plasmid#86770PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 6 (PSMB6 Human)
UseLentiviralTagsflagExpressionMammalianMutationPromoterunknownAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-MCS-P2A-EGFP
Plasmid#176276PurposeViral vector for co-expression of a CDS of interest and EGFP in cells expressing Cre AND NOT Flp driven by a Synapsin promoter. Contains an in-frame P2A sequence and an MCS for cloning of the CDS.DepositorInsertMCS-P2A-EGFP
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterhuman Synapsin IAvailable sinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
2XMyc-LRRK2-3XKD/Y1699C
Plasmid#25367DepositorInsertLRRK2 (LRRK2 Human)
UseTags2XMycExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…PromoterAvailable sinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-Fc-His
Plasmid#72089PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertNeo1.a (Neo1 Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR_K95M
Plasmid#108106PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation & kinase-dead mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation),…PromoterEFS promoterAvailable sinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302 ID2-V5 puro
Plasmid#83096PurposeLentiviral vector for constitutive expression of human ID2 with C-terminal V5 tagDepositorInsertID2 (ID2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorInsertDectin1A (CLEC7A Human)
UseTagsFusionRedExpressionMammalianMutationPromoterCMVAvailable sinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-TRE-flex-Clover
Plasmid#135177PurposeAAV expression of TRE(TRE3G)-driven, Cre-dependent, Clover expression for fluorescent lablingDepositorInsertsClover
TRE3G
UseAAVTagsExpressionMammalianMutationa variant of GFPPromoterTRE3GAvailable sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcsII-MECL1-flag
Plasmid#86774PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertimmunoproteasome beta subunit 2 (MECL1) (PSMB10 Human)
UseLentiviralTagsflagExpressionMammalianMutationPromoterunknownAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorInsertSema7a (Sema7a Mouse)
UseTagsFc-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-Cterm-NanoLuc-Puromycin
Plasmid#167209PurposePlasmid to clone recombination arms to create homologous recombination donor vector for C-terminal gene tagging with NanoLuc and selection with PuromycinDepositorTypeEmpty backboneUseCRISPRTagsNanoLucExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema3a(L, del13)-AP-His
Plasmid#72011PurposeExpresses the Sema3A protein (truncated at cleavage site P3; ie, long and missing exon 13), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertSema3a (Sema3a Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-deSpCas9-VP64-6xHis
Plasmid#92117PurposeExpression of dead/inactive increased fidelity eSpCas9 (1.1)-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive eSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, H840A, K848A, K1003A, R1060APromoterT7Available sinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only