-
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorArticleInsertsgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
UseTags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable sinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-shBIRC6-2
Plasmid#202449PurposeDOX-inducible expression of a short-hairpin RNA targetinging human BIRC6DepositorInsertBIRC6 shRNA (BIRC6 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-shBIRC6-2-C911
Plasmid#202450Purposea seed-matched control for pRSITEP-puro-shBIRC6-2DepositorInsertBIRC6 shRNA (BIRC6 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003-sgBIRC6-5
Plasmid#202439PurposeExpression of a guide RNA targeting BIRC6DepositorInsertBIRC6 gRNA (BIRC6 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only