-
-
-
-
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorInsertpCFD3-ovoD1 (ovo Fly)
UseCRISPRTagsExpressionInsectMutationPromoterU6:3Available sinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 CARD8-HA PAM S297A
Plasmid#169983PurposeTet/Dox-inducible mammalian expression of CARD8 that is autoprocessing-deficient (S297A) with sgRNA binding site mutationsDepositorInsertCARD8 (CARD8 Human)
UseLentiviralTagsHAExpressionMammalianMutationPAM, S297APromoterAvailable sinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-neo-sgROSA
Plasmid#105587Purposelentivirally express gRNA targeting ROSA26 locus with GFP marker and neo resistanceDepositorInsertgRNA targeting rosa26 locus
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
49535-sgFMR1_E17A
Plasmid#157782PurposeExpresses a sgRNA targeting stop codon of human FMR1 geneDepositorInsertFMR1 (FMR1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
MTK0_001
Plasmid#123924PurposeEncodes the spCas9 gRNA GFP dropout expression cassette with ConLS and ConRE connectors with Ampicillin resistance as a type 0 part to be used in the MTK systemDepositorInsertTU-sgRNA - L1/RE
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330.Pten.a
Plasmid#66587PurposesgRNA for Pten deletionDepositorInsertPten deletion (Pten Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
LentiGuide-Puro-CTRLg2 (CG510)
Plasmid#139456PurposeLentiviral vector with non-targeting gRNA and puromycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralTagsExpressionMammalianMutationPromoterEF-1a / U6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-5
Plasmid#109007PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorInsertATL1-sgRNA #5 (ATL1 Human)
UseLentiviralTagsExpressionMammalianMutationPromotermU6 promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
