We narrowed to 8,399 results for: sgRNA
-
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorInsertECT2 sgRNA spacer (ECT2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV/eGFP-U6-sgRNA
Plasmid#170544PurposeA lentiviral backbone for homology directed insertion of eGFP. Containing only eGFP, flanked by restriction sites for insertion of homology arms and a sgRNA casstte to clone in sgRNA for HDRDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#1
Plasmid#189987PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRTagsExpressionBacterial and PlantMutationPromoterAvailable sinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRTagsExpressionBacterial and PlantMutationPromoterU6 promoterAvailable sinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCi-mB2m-sgRNA
Plasmid#154090PurposepQCi backbone with sgRNA targeting murine Beta-2-microglobulinDepositorInsertsgRNA targeting murine B2M locus
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA2
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA2 (UFL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97308PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA1
Plasmid#134635Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA1 (UFL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-AAVS1_sgRNA
Plasmid#183891PurposepX459V2.0-HypaCas9 plasmid with sgRNA targeting the AAVS1 in human cells.DepositorInsertAAVS1 sgRNA spacer (AAVS1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_GAL4UAS-Luciferase reporter
Plasmid#64159PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA3 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-com-Ds
Plasmid#119077PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x com stem loopsDepositorInsertU6a:2xCom-sgRNA
UseTagsExpressionBacterialMutationPromoterZebrafish U6a promoterAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-MS2-Ds
Plasmid#119076PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x MS2 stem loopsDepositorInsertU6a:2xMS2-sgRNA
UseTagsExpressionBacterialMutationPromoterZebrafish U6a promoterAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX335 HTT sgRNA-a
Plasmid#87201PurposepX335 vector encoding SpCas9n and a chimeric guide RNA targeting exon 1 of HTTDepositorInsertHTT (HTT Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only