We narrowed to 8,732 results for: sgRNA
-
Plasmid#46170Purposeklp-12 targeting sgRNADepositorInsertklp-12 targeting sgRNA (klp-12 Synthetic)
UseCRISPRExpressionWormPromoterC. elegans U6 snRNA pol III promoterAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
px459-Hira KO sgRNA
Plasmid#186938PurposeHira KO in mouse ES cellsDepositorAvailable SinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCK005_U6-Sp-sgRNA_UP-TdTomato_WPRE
Plasmid#85453PurposeLentiviral CRISPR system backbone bearing BsmBI site for S. pyogenes new guide RNAs and TdTomato.DepositorInsertU6-sgRNA-Backbone-UP-TdTomato
UseCRISPR and LentiviralTagsNLSExpressionMammalianMutationdeletion of AA123-365 in tdTomato (please see dep…Available SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc-y1sgRNA-Cas9
Plasmid#49331PurposeExpresses sgRNA targeting yellow gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertsUseCRISPRTags3xFLAG and NLSExpressionInsectMutationHuman codon optimisedPromoterActin-5c and Drosophila U6Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCherry Codon 59 sgRNA
Plasmid#109431PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporterDepositorInsertmCherry codon 59 gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-sgRNA(siteT9)
Plasmid#154832PurposesgRNA for CRISPR/Cas9-mediated targeted integration into genomic site T9 in CHO cellsDepositorInsertsgRNA(siteT9)
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
SP6-sgRNA-scaffold
Plasmid#47912PurposeScaffold into which clone a 20 bp targeting sequence to generate a plasmid for in vitro transcription of an sgRNA using SP6 RNA polymerase for use in CRISPR-Cas by RNA injectionDepositorTypeEmpty backboneUseCRISPRTagssgRNA 3' endExpressionWormPromoterSP6Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #2
Plasmid#202519PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) TFRC
Plasmid#74709PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of TFRC mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-MsgRNA-EGFP
Plasmid#80794PurposeFor insertion of gRNA array containing 11-30 gRNA modulesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only