Showing: 41 - 56 of 56 results
-
-
-
-
-
-
-
-
-
-
-
-
pEY43
Plasmid#191047Purposeeat-4(prom6-1) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInserteat-4(prom6-1) (eat-4 Nematode)
UseTagsExpressionWormMutationNonePromoterAvailabilityAcademic Institutions and Nonprofits only -
-
pEY80
Plasmid#191075Purposeflp-18(AVA = 4.2-1k) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorInsertflp-18(AVA = 4.2-1k) (flp-18 Nematode)
UseTagsExpressionWormMutationNonePromoterAvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 41 - 56 of 56 results