-
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only
-
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PDG458 V3
Plasmid#226959PurposeCBh-SpCas9-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPH021
Plasmid#234346PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertsType II dCas9 sgRNA
Type II dCas9 sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterlacUV5Available sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(G:H)
Plasmid#138257PurposeExpression of GFP-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequence to be used in yeast dual reporter systemDepositorInsertGFP targeting sgRNAs G and H
UseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PDG458 eSp(1.1) V3
Plasmid#226964PurposeCBh-eSpCas9(1.1)-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 BsaI gRNA
Plasmid#99698PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA with BsaI cloning sites for programming, vector allows for strong activation of programmed target gene, can be packaged and delivered as AAVDepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceAug. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available sinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRGEB31
Plasmid#51295PurposeBinary vector derived from pRGE31. Deliver sgRNA and Cas9 into plants by agrobacterium mediated transformation.DepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterRice snoRNA U3 and dual 35S promoterAvailable sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
AIO-mCherry
Plasmid#74120PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and mCherry-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIO-GFP
Plasmid#74119PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and EGFP-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWRS_1001
Plasmid#192205Purposelentiviral expression of SpCas9 and two pol III promoters for dual expression of sgRNAsDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and RNAiTagsExpressionMutationPromoterAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNuc-cis
Plasmid#202796PurposeRK2-based conjugative plasmid containing the TevSpCas9 dual-endonuclease for targeted bacterial killingDepositorInsertTevSpCas9, sgRNA cassette, oriT, CenArsHis
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCBh; U6Available sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianMutationPromoterCbhAvailable sinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA151
Plasmid#215938PurposeFragmid fragment: (guide cassette) for dual expression sgRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v4; rev{H1_v1}
UseCRISPR; FragmentTagsExpressionMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialMutationPromoterT7Available sinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL452
Plasmid#219502PurposeGolden Gate entry vector for library cloning of msd-sgRNA arrays: GAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4tDepositorInsertGAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4t
UseTagsExpressionYeastMutationPromoterGAL7Available sinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCROPseq-VEX-optimized-scaffold
Plasmid#203321PurposeModified CROPseq vector for efficient CRISPR screens in hematopoiesisDepositorInsertsgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
UseTagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable sinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_CV2
Plasmid#167165PurposepgRNA_CV2 is derived from gRNA_cloning vector (Addgene plasmid ID: 41824) by adding about 80 bps from the sgRNA sequence as well as an AgeI site. In the literature, sgRNA_AL is used as an alias.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorInserturidine-cytidine kinase 2 (UCK2 Human)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorInserturidine-cytidine kinase 2 (UCK2 Human)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only