-
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN
Plasmid#124246PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in Agrobacterium- transformed plant cells.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN transient
Plasmid#124247PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in directly-transfected plant cells.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-15F11-HA-mCh
Plasmid#129591PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-mCherry (15F11-HA scFv-mCh)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLVX-opto-hCaspase-4 dCARD
Plasmid#208785PurposeInducibly expresses human Caspase 4 lacking the CARD domain, fused to light-activatable Cry2DepositorInsertCry2 mCherry Caspase4 dCARD (CASP4 Human)
UseLentiviralTagsCry2 mCherryExpressionMammalianMutationCARD domain is removedPromoterAvailable sinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryExpressionMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryExpressionMutationPromoterU6, GfaABC1DAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
UseTagsExpressionYeastMutationPromoterCryptococcus Histone3 promoterAvailable sinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
2xFKBP-mCh-KDEL
Plasmid#173010PurposeFKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of mCherry. Contains IRES following ORF for cloning cargo.DepositorInsert2xFKBP-mCh-KDEL
UseTagsmCherryExpressionMammalianMutationPromoterChicken beta actin (CAG)Available sinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
B1-INTEGRIN WT
Plasmid#195215PurposeMammalian expression of mCherry tagged B1 Integrin. Wild-type.DepositorInsertITGB1 (ITGB1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
UseTagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available sinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROSA26(MultiFPsΔPuro)
Plasmid#140759PurposeTargeting vector to Gt(ROSA)26 locus for conditional expression of distinct FPs (Venus, mCherry, and mCerulean) responding to each site-specific-recombinase activity (Cre, Dre, and phiC31o).DepositorInsertspuromycin-N-acetyltransferase
Venus
mCherry
mCerulean
UseMouse TargetingTagsExpressionMutationPromoterCAGGSAvailable sinceJune 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHD157
Plasmid#84033PurposeVector for creating transgenic zebrafish. Expresses mCherry-Cre fusion protein under the fabp10 promoter and Venus under the crystalin promoter in zebrafishDepositorInsertsCre
Venus
UseCre/Lox; Zebrafish transgenesisTagsmCherryExpressionMutationPromoterCrystalin and fabp10Available sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
B1-INTEGRIN VN
Plasmid#195216PurposeMammalian expression of mCherry tagged B1 Integrin. Autoclustering mutant.DepositorInsertITGB1 (ITGB1 Human)
UseTagsExpressionMammalianMutationV737NPromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only