-
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPnpr-4Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
UseTagsmCherryExpressionWormMutationPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-GFP
Plasmid#200068PurposeFor the knock down of GFP with an astrocyte specific mCherry expressionDepositorInsertU6-sgRNA-GFP
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryExpressionMutationPromoterU6, GfaABC1DAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sg-1
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACE-GIRK2-mC-S
Plasmid#172428PurposeExpression of full-length, human GIRK4 with C-terminal mCherry StrepTag IIDepositorInsertGIRK2 (KCNJ6 Human)
UseTagsmCherry Streptag IIExpressionInsectMutationPromoterAvailable sinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciTagsExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available sinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d23
Plasmid#59892Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with two seed sites mutatedDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd and fourth seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgFFL_d3
Plasmid#59891Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene with one seed site mutated.DepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPEST and VAMP 3 UTRExpressionMammalianMutationVAMP 3 UTR--3rd seed site removedPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN
Plasmid#124246PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in Agrobacterium- transformed plant cells.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDOE20 mC VN transient
Plasmid#124247PurposeAllows fluorescent (mVENUS; mCherry) co-localization of two proteins in directly-transfected plant cells.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pUCM-AAVS1-TO-hNGN2
Plasmid#105840PurposeDonor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuronDepositorInsertsUseCRISPR and TALENTagsExpressionMutationPromoterCAG, EF-1alpha, and TRE3GAvailable sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
UseTagsExpressionYeastMutationPromoterCryptococcus Histone3 promoterAvailable sinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-15F11-HA-mCh
Plasmid#129591PurposeThe encoded protein is the anti-HA scFv (anti-HA frankenbody) fused with the mCherry. It can be used to track mature and nascent HA tagged proteins in living organism.DepositorInsertAnti-HA frankenbody-mCherry (15F11-HA scFv-mCh)
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryExpressionMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable sinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMJ923
Plasmid#78313PurposeExpression of His6-MBP-tagged Cas9-NLS-mCherry protein in E. coliDepositorInsertSpCas9
UseTagsHA-2xNLS-mCherry-NLS and His6-MBP-TEVExpressionBacterialMutationhuman codon-optimized gene sequencePromoterT7Available sinceJune 7, 2016AvailabilityAcademic Institutions and Nonprofits only