Showing: 4601 - 4620 of 5864 results
-
Plasmid#145366PurposeCell-free/mammalian expression vector for Zika virus NS4A protein with N-term mCherryDepositorInsertZIKV NS4A
UseTags8xHis and mCherryExpressionBacterialMutationPromoterT7- CMV/CAGAvailabilityAcademic Institutions and Nonprofits only -
pmCellFree_KA2_ZIKV NS4B
Plasmid#145367PurposeCell-free/mammalian expression vector for Zika virus NS4Bprotein with N-term mCherryDepositorInsertZIKV NS4B
UseTags8xHis and mCherryExpressionBacterialMutationPromoterT7- CMV/CAGAvailabilityAcademic Institutions and Nonprofits only -
pmCellFree _KA2_ZIKV NS5
Plasmid#145368PurposeCell-free/mammalian expression vector for Zika virus NS5 protein with N-term mCherryDepositorInsertZIKV NS5
UseTags8xHis and mCherryExpressionBacterialMutationPromoterT7- CMV/CAGAvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgGAL4
Plasmid#121514PurposesgGAL4 control. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgGAL4
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6AvailabilityAcademic Institutions and Nonprofits only -
pPI304
Plasmid#113232Purposeextrachromosomal expression vector, expression of LifeAct-mCherry/PH-pkgE-GFPDepositorInsertLifeAct & pkgE-PH
UseDictyostelium discoideum expression vector, extra…TagsmCherry & GFPExpressionMutationPromoteract15AvailabilityAcademic Institutions and Nonprofits only -
pMIII-Neo-mChe
Plasmid#153423PurposeRetroviral (MSCV) expression of mCherry fluorescent proteinDepositorInsertmCherry
UseRetroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pCZGY847
Plasmid#135093PurposeTranscriptional mcherry reporter of acr-2 (cholinergic) expressing neurons in C. elegansDepositorInsertPacr-2
UseTagsmcherry and unc-10 3'UTRExpressionWormMutationPromoterPacr-2AvailabilityAcademic Institutions and Nonprofits only -
RFP-(SUMO)3
Plasmid#127150PurposeMammalian expression plasmid for mCherry-(SUMO)3 client to assess SUMO-SIM scaffolds.DepositorInsert3 copies of human SUMO1 separated by (GGS)4 (SUMO3 Human)
UseTagsExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
-
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPtrcAvailabilityAcademic Institutions and Nonprofits only -
pMJB1-RPS22B-Cl
Plasmid#160431PurposeExpresses "cre-less" yeast RPS22B tagged with mCherry under the GAL1 promoterDepositorInsertRPS22B (RPS22B Budding Yeast)
UseTagsmCherryExpressionYeastMutationRemoved introns, shuffled codons to change nucleo…PromoterGAL1 and S. cerevisiae GAL1AvailabilityAcademic Institutions and Nonprofits only -
pEN-R2-mCsfGFP-L3
Plasmid#178602PurposeIt can be used to study protein turnover in living plant cells of Arabidopsis (Arabidopsis thaliana) and Nicotiana benthamiana.DepositorInsertTandem fluorescent protein timers (tFTs)
UseEntry vector for gateway cloningTagsmCherry superfolder GFPExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC19/N-mChe
Plasmid#183159PurposePlant transient expression vector containing mCherry tag. Unique nucleotide sequences Uc and Ud for cloning at N terminus of mCherry.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe-C
Plasmid#183160PurposePlant transient expression vector containing mCherry tag. Unique nucleotide sequences Uc and Ud for cloning at C terminus of mCherry.DepositorTypeEmpty backboneUseTagsExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pUC19/mChe
Plasmid#183161PurposeConstruct for transient expression of cell nucleus-, cytoplasm-targeted mCherry in plants.DepositorInsertmCherry
UseTagsExpressionPlantMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pRB133.2
Plasmid#181950PurposeaTc-inducible expression of PhoP with C-terminal mNeonGreen fusion. Also contains mCherry under PhoP-controlled promoter PvirKDepositorInsertPhoP-Salmonella enterica subsp. enterica serovar Typhimurium (AX04_RS23485 Synthetic, PhoP-Salmonella enterica subsp. enterica serovar Typhimurium)
UseTagsmNeonGreenExpressionBacterialMutationPromoterPhoP-mNG-PLtetO-1; mCherry-PvirK; tetR-J23106AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-3xTS
Plasmid#162777PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to three tyrosine sulfation (TS) motifs. LaM4-3xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to three TS sites, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-1xTS
Plasmid#162778PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to one tyrosine sulfation (TS) motif. LaM4-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a TS site, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
UseTagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pJK2067
Plasmid#171845PurposeC. elegans mex-5 promoter (germline) driven dual fluorescent reporter for boxB tethering (eGFP) with boxB negative control (mCherry)DepositorInserthis-58, eGFP, mCherry
UseTagsN-terminal Tag OLLAS, V5 and C-terminal Tag PEST…ExpressionWormMutationboxB wild type and hairpin mutantPromotermex-5 promoterAvailabilityAcademic Institutions and Nonprofits only
Showing: 4601 - 4620 of 5864 results