We narrowed to 9,839 results for: CAG
-
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherry
Plasmid#84249PurposeExpresses Sp sgSV40 gRNA with a mCherry fluorescent markerDepositorInsertSp sgSV40
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8
Plasmid#121958PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, short version
ExpressionMammalianAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3050(gRNA XII-5)
Plasmid#73292PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable sinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 OCT4p eGFP SV40pA v2
Plasmid#115518PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows OCT4 dependent expression of GFP, and contains cHS4 insulators.DepositorInserteGFP
UseAAV; Donor plasmid for recombinase-mediated casse…ExpressionMammalianAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID5.3-C
Plasmid#145813PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAIDExpressionMammalianAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_CREB1_2
Plasmid#64940PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorPublicationInsertgRNA
UseCRISPRAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_2
Plasmid#64047PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorPublicationInsertgRNA
UseCRISPRPromoterU6Available sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pL1M-pMtRC-MtLAP1-Adh-R1
Plasmid#170790PurposeA Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic StudiesDepositorInsertMtLAP1 (LOC11412013 Medicago truncatula)
ExpressionBacterial and PlantPromoterMedtr4g059670(MtRC)Available sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-PDL1
Plasmid#159280PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven human PDL1/CD274 (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInsertHuman PDL1/CD274 (CD274 Human)
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001145598)
Plasmid#80173Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable sinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001145474)
Plasmid#77347Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MET gRNA (BRDN0001147257)
Plasmid#76063Purpose3rd generation lentiviral gRNA plasmid targeting human METDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only