We narrowed to 9,857 results for: CAG
-
Plasmid#42227DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPSD95
TagsTS:YSOG2ExpressionMammalianAvailable sinceMarch 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYS19
Plasmid#202084PurposeFrame -2 selector for NHEJ knock-inDepositorInsertpEF1a-mCherry-Cas9 + Frame ā2 sgRNA
UseCRISPRPromoterEF1aAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMyc4ElbLuc.
Plasmid#53246Purposereporter plasmid containing 4 myc cDNA binding sitesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpMyc4ElbLuc (MYC Human)
MutationTo prepare plasmids with one, two, three, and fouā¦Available sinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pG3
Plasmid#162604PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EED_2
Plasmid#36386DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro-shRFP
Plasmid#125778Purposeconstitutive expression of a short-hairpin RNA targeting RFPDepositorInsertshRFP
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Ezh2 (Ezh2 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMU-TLEr
Plasmid#61187PurposeFluorescent reporter for transitory late endosome mCherry-MtRAB7A2 expressed under AtUBQ10 promoterDepositorInsertMtRAB7A2
TagsmCherryExpressionPlantPromoterAtUBQ10Available sinceMarch 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORE303N
Plasmid#194438PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, KpnI site for gRNA insertionDepositorInsertCas9
UseCRISPRExpressionPlantPromoter2x35SAvailable sinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRb1/Cre
Plasmid#89647PurposeExpresses an Rb1-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgBLM10
Plasmid#127643PurposeKnock-out of human BLMDepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherry
Plasmid#84249PurposeExpresses Sp sgSV40 gRNA with a mCherry fluorescent markerDepositorInsertSp sgSV40
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA3.8
Plasmid#121958PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA, short version
ExpressionMammalianAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3050(gRNA XII-5)
Plasmid#73292PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
shCDK4/6(1)
Plasmid#73554Purposevector encoding both shRNA against CDK4(1) and shRNA against CDK6(1)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable sinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZ P (cHS4)X4 OCT4p eGFP SV40pA v2
Plasmid#115518PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows OCT4 dependent expression of GFP, and contains cHS4 insulators.DepositorInserteGFP
UseAAV; Donor plasmid for recombinase-mediated casseā¦ExpressionMammalianAvailable sinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only