-
Plasmid#77321Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001146491)
Plasmid#77323Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0004
Plasmid#42244DepositorInsertgRNA-fh site #2 (fh Zebrafish)
UseCRISPR; Zebrafish expressionTagsExpressionMutationPromoterT7Available sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_1
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ADRBK2 gRNA (BRDN0001487158)
Plasmid#77943Purpose3rd generation lentiviral gRNA plasmid targeting human ADRBK2DepositorInsertADRBK2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS74 (synthetic guide::∆HYGR::unc-54 3' UTR^SEC)
Plasmid#154838PurposeInsertion of split hygromycin landing pad into ChrII:8420157 site C. elegans strains via CRISPR with SEC selectionDepositorInsertsynthetic guide::∆HYGR::unc-54 3' UTR
UseCRISPR and Cre/LoxTagsExpressionWormMutation∆HYGR is promoterless and encodes aa 60-341PromoterAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0005
Plasmid#42245DepositorInsertgRNA-gsk3b (gsk3b Zebrafish)
UseCRISPR; Zebrafish expressionTagsExpressionMutationPromoterT7Available sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV
Plasmid#136380PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation systemDepositorInsertAaCas12b (D570A)-TV
UseCRISPRTagsExpressionPlantMutationD570APromoterAvailable sinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorInsertpCFD3-ovoD1 (ovo Fly)
UseCRISPRTagsExpressionInsectMutationPromoterU6:3Available sinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Vps39-g1)-PGKpuroBFP-W
Plasmid#105019PurposeLentiviral gRNA plasmid targeting mouse Vps39 , co-expression of TagBFPDepositorInsertVps39 (Vps39 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only