Showing: 381 - 400 of 402 results
-
Plasmid#124985PurposeExpress the Helicobacter hepaticus specific TCRa/b HH5-5 in T cell hybridoma cellsDepositorInsertHH5-5 TCRa P2A TCRb
UseretroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
RV-mCD4-HH7-6
Plasmid#124990PurposeExpress the Helicobacter hepaticus specific TCRa/b HH7-6 in T cell hybridoma cellsDepositorInsertHH7-6 TCRa P2A TCRb
UseretroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
RV-mCD4-HH7-8
Plasmid#124991PurposeExpress the Helicobacter hepaticus specific TCRa/b HH7-8 in T cell hybridoma cellsDepositorInsertHH7-8 TCRa P2A TCRb
UseretroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
RV-mCD4-HH7-9
Plasmid#124992PurposeExpress the Helicobacter hepaticus specific TCRa/b HH7-9 in T cell hybridoma cellsDepositorInsertHH7-9 TCRa P2A TCRb
UseretroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
RV-mCD4-HH7-11
Plasmid#124993PurposeExpress the Helicobacter hepaticus specific TCRa/b HH7-11 in T cell hybridoma cellsDepositorInsertHH7-11 TCRa P2A TCRb
UseretroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
-
pBABE-puro HGF
Plasmid#10901DepositorInsertHGF (HGF Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
RNAPII_CTD43-52
Plasmid#98684PurposeExpresses 6xHis-tagged C-terminal domain of RNA polymerase IIDepositorInsertRNA polymerase II C-terminal domain (POLR2A Human)
UseTags6xHisExpressionBacterialMutationhepatds 43-52, residues 1888-1970PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-TBG-Cyto-TurboID
Plasmid#149414PurposeHepatocyte-specific expression of cytosolic TurboID, N-term V5 tag, in AAV expression plasmid. Amp selectionDepositorInsertCyto-TurboID
UseAAVTagsV5ExpressionMutationPromoterTBGAvailabilityAcademic Institutions and Nonprofits only -
pAAV-TBG-ER-TurboID
Plasmid#149415PurposeHepatocyte-specific expression of ER-localized TurboID, N-term HA tag, C-term V5 tag, in AAV expression plasmid. Amp selectionDepositorInsertER-TurboID
UseAAVTagsHA and V5ExpressionMutationPromoterTBGAvailabilityAcademic Institutions and Nonprofits only -
pET21b-hHNF4aORF-1
Plasmid#206959PurposeThe ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the NheI/NotI sites of the pET21b(+), the bacterial expression vector.DepositorInsertHNF4a (Hepatocyte Nuclear Factor alpha4 Variant 2) (HNF4A Human)
UseTagsExpressionBacterialMutationPromoterT7AvailabilityAcademic Institutions and Nonprofits only -
pCS2 HRS-RFP
Plasmid#29685DepositorInserthepatocyte growth factor-regulated tyrosine kinase substrate (HGS Human)
UseTagsRFPExpressionMammalianMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-TBG-mem-TurboID
Plasmid#149413PurposeHepatocyte-specific expression of secretory pathway membrane-localized TurboID, N-term HA tag, C-term V5 tag, in AAV expression plasmid. Amp selectionDepositorInsertmem-TurboID
UseAAVTagsHA and V5ExpressionMutationPromoterTBGAvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-p53mut
Plasmid#99239PurposeMutant p53 encoded by AS-30D rat hepatoma cell lineDepositorInsertp53 (Tp53 Rat)
UseTagsExpressionMammalianMutationSilent mutations in translated protein at Gly (10…PromoterCMV immediate/early enhancer/promoterAvailabilityAcademic Institutions and Nonprofits only -
-
pCI-Neo-HKIImut
Plasmid#99240PurposeType II Hexokinase expressed in AS-30D rat hepatoma cell lineDepositorInsertHexokinase II (Hk2 Rat)
UseTagsExpressionMammalianMutationFour silent mutations; P (115)L, A (192) V, F (78…PromoterCMV I.E.AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailabilityAcademic Institutions and Nonprofits only -
pWAP-HGF
Plasmid#83503PurposeGeneration of transgenic mice overexpressing the HGF under the control of the WAP gene promoterDepositorInsertHGF (Hgf Mouse)
UseMouse TargetingTagsExpressionMutationalso contains beta-globin sequences from pUC198Promotermouse WAP (whey acidic protein)AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVTagsExpressionMutationNAPromoterCAGAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA
Plasmid#183776PurposeAAV genome with a CAG driven Cre recombinase with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertCre
UseAAVTagsExpressionMutationNAPromoterCAGAvailabilityAcademic Institutions and Nonprofits only
Showing: 381 - 400 of 402 results